We narrowed to 14,321 results for: cas9
-
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable sinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only
-
LentiCRISPR-sgPREX1
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-ACTB
Plasmid#183868PurposeRepair template for the N-terminal tagging of beta-actin with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertACTB homology arms with mRuby2-linker (ACTB Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#1
Plasmid#174150PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C4
Plasmid#229849PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.DepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Human Brunello kinome pooled library, guides 5-8 in lentiCRISPRv2 backbone
Pooled library#75315PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorInsertChr1q gRNA
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-C
Plasmid#190337PurposeExpressing the C-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-C, PCSK9 +1A insertion pegRNA
UseAAVAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v4
Plasmid#158032Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette with modified tracrRNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK1
Plasmid#138692PurposeExpresses a human NUAK1-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK2
Plasmid#138693PurposeExpresses a human NUAK2-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGE463
Plasmid#153234PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE667
Plasmid#153232PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only