We narrowed to 6,024 results for: aaas
-
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPEgRNA
Plasmid#172716PurposeDelivery of guide RNA for prime editingDepositorInsertgRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWT016g
Plasmid#96849Purposeprocessed HHR-sgRNA-GFPDepositorInsertprocessed HHR-sgRNA-GFP
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pTargetF
Plasmid#62226PurposeConstitutive expression of sgRNA without donor editing template DNADepositorInsertsgRNA
UseCRISPRExpressionBacterialPromoterpij23119Available SinceMarch 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9-ScaligD
Plasmid#125688PurposeGene knockout/in for actinomycetesDepositorInsertstreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
(pRZ294) AAV: U6-gRNA-EF1a-ZsGreen
Plasmid#254586PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ115) AAV: U6-gRNA-EF1a-mCherry
Plasmid#254584PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNC-gRNA7
Plasmid#249206PurposesgRNA controlDepositorInsertNon-Targeting
UseCRISPR and LentiviralPromoterU6Available SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AagRNA
Plasmid#121953PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b tracrRNA/crRNA duplex
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3GB411
Plasmid#134748PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-VR
Plasmid#62286Purposeexpression of VR sgRNA from the arabinose-inducible promoterDepositorInsertVR sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only