We narrowed to 58,415 results for: LAT
-
Plasmid#89816PurposeKnockdown human STIM1 expressionDepositorInsertSTIM1 shRNA (STIM1 Human)
UseRetroviralAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::PuroR-bGHpA
Plasmid#62439PurposeMXS_chaining vector with CMV::PuroR-bGHpADepositorInsertresistance cassette against Puromycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-Cdh1wt (570)
Plasmid#39877DepositorAvailable SinceMarch 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
CD200RCd4d3+4-bio
Plasmid#32406PurposeA positive control receptor bait (rat CD4d3+4-bio) and prey (rat CD200 receptor) EXPRESs plasmid for The Basic AVEXIS kitDepositorInsertCD200 Receptor extracellular domain (Cd200r1 Rat)
TagsCd4d3+4 and biotinylation peptideExpressionMammalianPromoterCMVAvailable SinceJan. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJFRC156-21XUAS-B2RT>-dSTOP-B2RT>-myr::RFP
Plasmid#32135DepositorInsertB2RT> STOP STOP B2RT>
ExpressionInsectAvailable SinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2 hSmad1-GM
Plasmid#22992DepositorAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBS/KS-mId3sp
Plasmid#16045DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSKA413
Plasmid#80381PurposeConstitutive CcaS and CcaR with gfpmut3 under the cpcG2Δ59 promoter.DepositorInsertsccaS (complement)
ccaR (complement)
gfpmut3
UseSynthetic Biology; OptogeneticsTagsFLAG tagExpressionBacterialPromoterccaR and cpcG2Δ59Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNAI-GAL4-CREB-S142A
Plasmid#46771PurposeExpression of GAL4 fusion to CREB-S142ADepositorTagsGAL4ExpressionMammalianMutationChanged CREB serine 142 to AlaninePromoterCMVAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Flag-Cdk9-T186A-IRES-eGFP
Plasmid#28097DepositorInsertCdk9 (CDK9 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationContains T186A mutation in Cdk9Available SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Flag-Cdk9-D167N-IRES-eGFP
Plasmid#28098DepositorInsertCdk9 (CDK9 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationContains D167N mutation in Cdk9Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_2_SpGCas9
Plasmid#233457PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorInsertLevel 2 RECKLEEN plasmid
UseCRISPRAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJAT30
Plasmid#204294PurposeFor marking CRISPR HDR integrant with DsRed expressed in flight muscles. Second U6 promoter for using two gRNAs.DepositorInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1
Plasmid#194278PurposeExpresses gRNA and dSaCas9-KRAB from lentiviral vectorDepositorInsertshumanized dSaCas9 KRAB T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR-Hygro
Plasmid#176063PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertLivePAR
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-NEUROD1-T2A-PuroR
Plasmid#162338PurposeLentiviral expression of NEUROD1 under the control of the TetON promoterDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTUB1:YFP-AID-3HA, DHFR-TS:HXGPRT
Plasmid#87260PurposeYFP-AID-3HA fusion driven by a minimal TUB1 promoter with an HXGPRT drug selectable marker. The AID CDS is Arabidopsis thaliana auxin-responsive protein IAA17.DepositorInsertsYFP-AID-3HA
HXGPRT
UseToxoplasma expressionTags3HA and AIDPromoterTgDHFR-TS 463 bp and TgTUB1 378 bpAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only