We narrowed to 25,809 results for: Spr
-
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRE
Plasmid#139088PurposeExpresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationA262T, R324L,S409I, E480K, E543D, M694I, E1219VAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1
Plasmid#101177PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN497A/R661A/Q695A/K848A/Q926A/K1003A/R1060APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-MAPRE1
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVD1 M1_1-pTRNA-scf 2.1 (GB2603)
Plasmid#160568PurposetRNA and scaffold 2.1 scRNA aptamer Ms2 for the assembly of GBoligomers for a single position of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_1-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEN-CMV-VPR-WT CjCas9 V-WT
Plasmid#169914PurposeExpression of VPR-WT CjCas9 fusion protein to induce orthogonal genes knock out and activation.DepositorInsertCjCas9
UseCRISPRTags2xSV40NLS, SV40NLS-HA, and VPR (VP64-p65-Rta)ExpressionMammalianPromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant
Plasmid#101231PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N692A, M694A, Q695A an…PromoterT7Available SinceNov. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Halo-CD4-bla
Plasmid#179451PurposeDonor vector to knock in Halotag C-terminal to human PER2 geneDepositorAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-Luciferase-hvTK-bla
Plasmid#179444PurposeDonor vector to knock in firefly Luciferase C-terminal to human CRY1 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-IRES-mCherry
Plasmid#188770PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only