We narrowed to 84,770 results for: ell
-
Plasmid#110163PurposeExpression of human RAPGEF2 (S1244A/S1248A) in mammalian cellsDepositorInsertRAPGEF2 (Rap guanine nucleotide exchange factor 2 (RAPGEF2 Human)
TagsHAExpressionMammalianMutationS1244A/S1248APromoterCMVAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK33
Plasmid#116797PurposeLentiviral expression of STK33DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD5 (OTU, aa 171-358)
Plasmid#61415PurposeExpresses human OTUD5 (OTU domain) in E. coli.DepositorInsertOTUD5 (OTUD5 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-170 and aa 359-571.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK19
Plasmid#116795PurposeLentiviral expression of STK19DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-MAVS(pLxIS)
Plasmid#221256PurposeExpression of MAVS pLxIS (393-441) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-extGluc-NGFR
Plasmid#104832PurposeextGluc luciferase for invivo Imaging, NGFR for flourescent detection or separationDepositorInsertsextGLuc
NGFR
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4TO R124A K125A CoV-2 nsp1 3xFLAG
Plasmid#176059PurposeExpressing R124A K125A CoV2 nsp1 in mammalian cells. This contains a C-terminal 3xFLAG tag fusion to nsp1.DepositorInsertCoV-2 nsp1 R124A/K125A (ORF1ab SARS-CoV-2)
Tags3xFLAGExpressionMammalianMutationR124A and K125APromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LILRA3-COMP5AP-AviTag-9xHis
Plasmid#157410PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-NEMO
Plasmid#221267PurposeExpression of TASL-NEMO IKK binding site in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-PLPLR
Plasmid#221266PurposeExpression of TASL-STING PLPLR in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OS
Plasmid#136576PurposeDox-inducible polycistronic lentiviral vector expressing mouse Oct4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICOZ-SB100X[EF1α-CD19 4-1BB-eGFP]
Plasmid#218343PurposeDonor plasmid of SB100X Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.3-PGK-dTomato
Plasmid#89606PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-STAT4-P2A-mCherry
Plasmid#203853PurposeTet-inducible lentiviral plasmid expressing STAT4-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertSTAT4 (STAT4 Human)
ExpressionMammalianAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LARG mtq sspB in pcDNA3.1
Plasmid#90460PurposeRhoA mediated cell migrationDepositorInsertsExpressionMammalianMutationR73Q and deletion a.a. (234-239)Available SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only