We narrowed to 61,828 results for: promoter
-
Plasmid#194287PurposeExpression plasmid for zebrafish or Danionella cerebrumDepositorInsertkdrl promoter from Addgene plasmid # 78687 (kdrl Zebrafish)
UseZebrafish or danionella cerebrum expressionTagsmCherryCAAX from the Tol2kit (Kwan et al., 2007)Promoterkdrl(flk1)Available sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5 ∆UBR
Plasmid#81063PurposeGateway entry vector encoding full length UBR5 W1235L (∆UBR)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆UBR (UBR5 Human)
UseCloningMutationW1235L (bp g3704t)PromoterN/AAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5 ∆HECT
Plasmid#81065PurposeGateway entry vector encoding full length UBR5 C2768A (∆HECT)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆HECT (UBR5 Human)
UseCloningMutationC2768A (bp t8302g and g8303c)PromoterN/AAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-oScarlet
Plasmid#137138PurposeIntersectional viral expression of oScarlet in cells expressing Flp AND NOT CreDepositorHas serviceAAV8InsertCoff/Fon-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
ExpressionPlantAvailable sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable sinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_1-205 USP7
Plasmid#131245PurposeMammalian expression of the USP7 TRAF-like domain with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationExpresses a mutant form of our pcDNA3.1-N-Myc_1-5…Available sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dub3 mouse
Plasmid#72682Purposemammalian expression of mouse Dub3DepositorAvailable sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pbZIP9:GFP-GUS
Plasmid#172483PurposeGFP-GUS driven by the bZIP9 promoterDepositorAvailable sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
EEF1A2 in pENTR
Plasmid#216585Purposegateway cloning donor vector containing EEF1A2DepositorInsertEEF1A2 (EEF1A2 Human)
UseGateway CloningAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn-PdCO-EGFP-WPRE
Plasmid#198513PurposeExpresses optimized PdCO in frame with EGFP under control of human synapsin1 promotor.DepositorHas serviceAAV1 and AAV5InsertPdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterhSyn1Available sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
KG#121
Plasmid#110879PurposeExpresses the C. elegans unc-31 cDNA pan-neuronallyDepositorInsertsrab-3 promoter
unc-31 cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationMissing first 408bpAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E2_RPS5ADIPS
Plasmid#248053PurposeGateway CloningDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantAvailable sinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTP2-AAV-PARD3Benhancer-mCherry
Plasmid#254714PurposeThis AAV vector contains an enhancer that drives mCherry expression in spinal cord skeletal motor neurons of gamma subtype. Specificity of vector not characterized outside the mouse spinal cord.DepositorInsertPard3b enhancer, mini promoter, synthetic intron, mCherry, WPRE (Pard3b Mouse, Synthetic)
UseAAV and Mouse TargetingExpressionMammalianAvailable sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only