We narrowed to 12,610 results for: NSI
-
Plasmid#221912PurposeTransient expression of GFP-tagged CBPdeltaIDR6deltaAL in mammalian cellsDepositorInsertCBP (CREBBP Human)
TagsGFPExpressionMammalianMutationdeletion of IDR6 (aa 1856-2090); deletion of the …Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VcnTS-E1015A-E1021A
Plasmid#213411PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A), in lentiviral expression vector.DepositorInsertVcnTS-E1015A-E1021A (VCL Chicken, Synthetic)
UseLentiviralMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Parkin(C431N)-A92mKO2
Plasmid#213545PurposeTransient mammalian expresssion of ligase-dead C431N Parkin, internally tagged with mKO2DepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K363TAG)
Plasmid#182661PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K363 & an N-terminal FLAG tag (DYKDDDDK) in mammalian cells. Can be used for genetic code expansion & click labeling of NFL.DepositorInsertmouse neurofilament light chain with a K363TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK363TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1cdN243-C1
Plasmid#131838PurposeExpresses the last 50 amino acids of HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a deletion contruct of the cytoplasmic m…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPMMLF1nes-C1
Plasmid#131849PurposeExpresses the N-terminal nuclear export signal of HcRed-NPMMLF1 in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a control deletion contruct of the cytop…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGB_3alpha2 OplacI:mini35S:RDF:Tnos (GB1534)
Plasmid#160617PurposeTU for the regulated expression of the PhiC31 phage recombination directionality factor (RDF) gene driven by a synthetic promoter consisting of the LacI operator fused to the minimal 35S promoter.DepositorInsertRDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha2 OplexA:mini35S:PhiC31int:Tnos (GB1529)
Plasmid#160614PurposeTU for the regulated expression of the PhiC31 phage integrase gene driven by a synthetic promoter consisting of the LexA operator fused to the minimal 35S promoter.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB_3alpha1 OplacI:mini35S:phiC31:Tnos (GB1530)
Plasmid#160615PurposeTU for the regulated expression of the PhiC31 phage integrase gene driven by a synthetic promoter consisting of the LacI operator fused to the minimal 35S promoter.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1680_Sororin-Cterm
Plasmid#156451PurposeFor transient expression of Cas9 and sgRNA targeting mouse Cdc5a (SORORIN) stop codonDepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A LaG17-SynNotch 204TAA 442TAG
Plasmid#154778Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and LaG17-SynNotch 204TAA 277TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertLaG17-SynNotch
TagsLaG17ExpressionMammalianMutation204TAA 442TAG in LaG17-SynNotch, hybrid PylT with…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-3
Plasmid#112843Purposetransient/stable overexpression of the C-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-1
Plasmid#112841Purposetransient/stable overexpression of the N-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable SinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1396
Plasmid#29194PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1617
Plasmid#29279PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle146 (NTSR1 Human)
UsePleiades promoter project [sic, pleaides plieades…TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOUPc-Rh159-GFP
Plasmid#179280PurposeAll in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.DepositorInsertRh159 fused to eGFP
UseLentiviral; All-in-one "tet" on lentivi…TagseGFPExpressionMammalianPromoterTet Responsive Element 3GAvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailabilityAcademic Institutions and Nonprofits only