-
Plasmid#197201PurposeExpresses the protein of miRFP670-2 in mammalian cellsDepositorInsertmiRFP670-2
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-AP-2 σ2
Plasmid#198345PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-2 σ2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-2 σ2
UseTagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationR42G substitution, and silent substitutions in co…PromoterADH1Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NHERF1-PDZ1-2
Plasmid#28294DepositorInsertNHERF1 (NHERF1 Human)
UseTagsFLAGExpressionMammalianMutationContains aa 1-298 (deletion of the EB domain aa 2…PromoterAvailable sinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1 GFR alpha 2
Plasmid#119899PurposeMouse GFR alpha 2 In situ hybridization probeDepositorInsertGDNF family receptor alpha-2 (Gfra2 Mouse)
UseIn situ hybridization probeTagsExpressionMutationPromoterAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-BA.2-AVI
Plasmid#184534PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-BA.2 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, S371F, S373P, S375F, T376A, D405N, R408S, …PromoterAvailable sinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2
Plasmid#173952PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45
UseLuciferaseTagsExpressionMutationNonePromoterSV40 promoterAvailable sinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.35_S1-2
Plasmid#173953PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertEnhancer regions 1 and 2 (S1 and S2) from SOX9 enhancer cluster EC1.35
UseLuciferaseTagsExpressionMutationNonePromoterSV40 promoterAvailable sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2
Plasmid#173949PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45
UseLuciferaseTagsExpressionMutationNonePromoterSV40 promoterAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eNme2-T.2-ABE8e
Plasmid#185669PurposeExpresses eNme2-T.2-ABE8e in mammalian cellsDepositorInsertecTadA(8e)-neNme2-T.2
UseCRISPRTagsExpressionMammalianMutationNme2Cas9 D16A/E47K/R63K/V68M/A116T/T123A/D152N/E1…PromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX SH3(2)-4R
Plasmid#112090PurposeBacterial expression plasmid containing a GST tag with 4 repeats of the second SH3 domain from human NCK1.DepositorInsertSH3(2)-4R (NCK1 Human)
UseTagsGSTExpressionBacterialMutationPromoterLacAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX SH3(2)-3R
Plasmid#112091PurposeBacterial expression plasmid containing a GST tag with 3 repeats of the second SH3 domain from human NCK1.DepositorInsertSH3(2)-3R (NCK1 Human)
UseTagsGSTExpressionBacterialMutationPromoterLacAvailable sinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAL-SH3(2)-5R
Plasmid#112089PurposeBacterial expression plasmid containing His and MBP tags for 5 repeats of the second SH3 domain from human NCK1.DepositorInsertSH3(2)-5R (NCK1 Human)
UseTagsHis6 and MBPExpressionBacterialMutationconstruct contains only repeats of the second SH3…PromoterLacAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1410 - [1-2] ENTR - Fluor - mCherry(PATCs, NLS(2), no_atg, no_stop)
Plasmid#159859PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mCherry(PATCs, NLS(2), no_atg, no_stop)
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1985 - [1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
Plasmid#159846PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCx43-7-miRFP670-2-N1
Plasmid#197223PurposeExpresses the fusion protein of Cx43-7-miRFP670-2 in mammalian cellsDepositorInsertCx43-7-miRFP670-2
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only