We narrowed to 5,540 results for: KRAS
-
Plasmid#191344PurposeOptogenetic toolDepositorInserthMela(CTmGluR6)
TagsIRES_TurboExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FoxFTVC+bpFOG_MRAS-G22V
Plasmid#107521PurposeConstitutive activation of FGF/MAPK pathway by M-Ras-G22V mutantDepositorInsertM-Ras protein
Mutationchanged Glycine 22 to ValinePromoterTVC-specific FoxF enhancer (FoxFTVC+bpFOG)Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH50
Plasmid#128212Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK007
Plasmid#128220Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH72
Plasmid#128221Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH73
Plasmid#128222Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH74
Plasmid#128223Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH90
Plasmid#128203PurposecrRNA backbone for FnCas12a/CmsI nucleases, combine with TaU3 promoter module (pFH33)DepositorInsertcrRNA backbone for FnCas12a/CmsI nucleases, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH104
Plasmid#128209PurposecrRNA backbone for FnCas12a/CmsI nucleases, combine with AtU6-26 promoter module (pFH35)DepositorInsertcrRNA backbone for FnCas12a/CmsI nucleases, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-ZKSCAN1 548-847
Plasmid#69902PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 Sense
Plasmid#69883PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-THAP11(AA132-313)
Plasmid#37002DepositorInsertTHAP11(AA132-313) (THAP11 Human)
TagsGSTExpressionBacterialMutationAmino acids 132 to 313Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
MYC-CRISPR
Pooled Library#173195PurposeThis pooled lentiviral CRISPR knockout library targets E-boxes genome-wide and can be applied for identification of essential MYC binding sites in a wide range of human cells.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR1063
Plasmid#111091PurposeExpresses dCas9-KRAB tagged with mCherry: pHR-hEF1a-dCas9-mcherry-KRAB-mPGK-HygDepositorInsertdCas9-KRAB
UseLentiviralTagsmCherryAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-WT Split GFP + Sense IRES
Plasmid#69909PurposeExpresses a GFP circular RNA containing the sense EMCV IRES in mammalian cellsDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH424-ssr
Plasmid#198026PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Sm resistance cassette
ExpressionBacterialPromoterSmR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH124-ssr
Plasmid#198025PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Ap/Cb resistance cassette
ExpressionBacterialPromoterApR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH824-ssr
Plasmid#198027PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Apr resistance cassette
ExpressionBacterialPromoterAprR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway-compatible entry vectorAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only