We narrowed to 3,374 results for: N-EGFP
-
Plasmid#227237PurposeLarge capacity AAV that expresses eGFP in neurons expressing Cre recombinaseDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Venus-BimEL(Noxa)-pEGFP-C1
Plasmid#166761PurposeTo examine effect of swapping the BH3 region in full length BimEL with that of NoxaDepositorTagsVenusExpressionMammalianMutationBH3 region removed and inserted BH3 of human Noxa…PromoterCMVAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-77:TERF2-mEGFP
Plasmid#168798PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human TERF2.DepositorInsertTERF2 (TERF2 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceApril 14, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP_TOMM20_sfCherry2(11)
Plasmid#83033PurposeExpresses sfCherry2(11) tagged TOMM20 (human) in mammalian cells cellsDepositorInsertTOMM20_sfCherry+11
ExpressionMammalianAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-CIBN-eGFP-CAAX-Puro
Plasmid#240804PurposeConstitutive expression of CIBN-eGFPDepositorInsertCIBN-eGFP
UseSynthetic BiologyExpressionMammalianMutationnonePromoterCAGAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EK0294 SFFV-mCherry-SG(s70587-W)SG-EGFP (FLP-IN)
Plasmid#191141PurposePositive control for Sensor 1 (EK0285) where the TAG stop codon is replaced with TGG tryptophan codonDepositorInsertmCherry:s70587-W:EGFP
ExpressionMammalianMutationUAG>UGG (stop>Trp)PromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP(HiBiT)
Plasmid#162589PurposeN-terminally HiBiT-tagged EGFP under CAG promoterDepositorInsertEGFP
TagsHiBiTExpressionMammalianPromoterCAG promoterAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-C-IFT172
Plasmid#218734PurposeExpresses N-terminally EGFP-tagged IFT172 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EGFP-C3-Cep123
Plasmid#73330PurposeLentiviral vector encoding Cep123 isoform 1 with an N-terminal EGFP tagDepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
eGFP-Silicatein-pET28
Plasmid#198012PurposeC-terminal eGFP fusion to truncated silicatein insert with N- and C-terminal hexahistidine tag for purificationDepositorInserteGFP-silicatein
Tagshexahistidine tagExpressionBacterialPromoterT7Available SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP
Plasmid#50457PurposeDouble floxed EGFP under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-mSNX27
Plasmid#163617Purposemouse SNX27 cDNA N-terminally tagged with GFPDepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG
Plasmid#46956PurposePlasmid for cloning and expression of GFP-FLAG tagged proteins (N-terminal tag). Confers resistance to G418.DepositorInsertFLAG tag
ExpressionMammalianPromoterCMVAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAVEC2_C-mEGFP
Plasmid#231295PurposeFor transiently expressing fusion proteins with C terminally tagged mEGFP in plants (includes p19 silencing suppressor)DepositorTypeEmpty backboneTagsmEGFPExpressionPlantMutationN/AAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP N1 Ub-CRT
Plasmid#69619PurposeExpress cytoplasmic mature CRT.DepositorInsertUbiquitina-Calreticulin (mature)
TagsEGFP and UbiquitinExpressionMammalianMutationDeletion of signal peptide of calreticulin at the…PromoterCMVAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
EGFP-WASP-3D
Plasmid#242836PurposeEncodes human WASP and N-terminal EGFP tagDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKIIa(0.4)-stChrimsonR-EGFP-P2A-PdCO-WPRE
Plasmid#202198PurposeExpresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the optimized PdCO under control of minimal CamKIIa promotorDepositorInsertstChrimsonR, PdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1-WPRE
Plasmid#250370PurposeLentiviral expression of human MTHFD1 with N-terminal EGFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only