We narrowed to 3,016 results for: EXO
-
Plasmid#170868PurposeMammalian expression of dGFP-Granuphilin.DepositorAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pBS_KS_attB2_SA(2)_T2AGeneSwitch
Plasmid#125216PurposeArtificial phase 2 exon to include a spliced T2A-GeneSwitch effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGeneSwitch
UseOtherTagsT2AAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(2)_T2AGAL80
Plasmid#125219PurposeArtificial phase 2 exon to include a spliced T2A-GAL80 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL80
UseOtherTagsT2AAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(1)_T2AGeneSwitch
Plasmid#125215PurposeArtificial phase 1 exon to include a spliced T2A-GeneSwitch effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGeneSwitch
UseOtherTagsT2AAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
miR766 in pcDNA3.1
Plasmid#78124PurposeMammalian expression of miR766DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-TREX1(D18N)
Plasmid#27220DepositorInsertTREX1 (TREX1 Human)
TagsGFPExpressionMammalianMutationD18N sequence 52-GAC changed to AAC, resulting i…Available SinceJan. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCasRx-RBM25
Plasmid#221001PurposeTransient expression of dCasRx-RBM25. EF1a promoter.DepositorInsertdCasRx-RBM25
UseCRISPRTagsNLS and NLS-HAExpressionMammalianPromoterEF1aAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046921
Plasmid#145755PurposeBacterial Expression plasmid for SARS-CoV-2 3'-to-5' exonucleaseDepositorInsertSARS-CoV-2 3'-to-5' exonuclease (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 28, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3 CMV Cyclone-EGFP
Plasmid#247495PurposeAcyclovir-regulated EGFPDepositorInsertEGFP gene with Cyclone insertion
UseSynthetic BiologyExpressionMammalianMutationCyclone was inserted after Glutamine94 of EGFP to…PromoterCMVAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Lifeact-tdTomato
Plasmid#64048PurposeFluorescent reporter for F-actin labeling in living cellsDepositorInsertLifeact
UseLentiviralTagstdTomatoExpressionMammalianPromoterUbiquitinAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP VAMP2
Plasmid#42308DepositorInsertVAMP 2
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pACE WT SOX pACEmam1
Plasmid#192049PurposeExpresses WT SOX (pACEmam1)DepositorInsertWT SOX
UseUnspecifiedPromoterCMVAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
mApple-hCOL1A1
Plasmid#140113PurposeExpresses fluorescently-tagged human Type I procollagen α1 chain with mApple replacing exon 2-3 retaining N-propeptide minor triple helix and N-terminal cleavage siteDepositorInsertType I procollagen α1 (COL1A1 Human)
TagsmAppleExpressionMammalianMutationCOL1A1 exons 2-3 replaced by fluorescent tagPromoterCMVAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 SV40 Cyclone-RLuc
Plasmid#247494PurposeAcyclovir-regulated Renilla luciferaseDepositorInsertRenilla luciferase gene with Cyclone insertion
UseLuciferase and Synthetic BiologyExpressionMammalianMutationCyclone was inserted after Q288 of Renilla lucife…PromoterSV40Available SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
His-GFP SNAP25
Plasmid#170872PurposeMammalian expression of His-GFP SNAP25.DepositorAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI-SEP_NR2B
Plasmid#23998DepositorInsertNR2B (Grin2b Rat)
TagsNR2B signal sequence (aa1-31) and SEP (supereclip…ExpressionMammalianPromoterCMVAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ TREX1-KI
Plasmid#127701PurposeFor knocking in TREX1 in mouse - Doxycyclin inducibleDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-SEP_NR2A
Plasmid#23997DepositorAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only