We narrowed to 3,262 results for: ICL
-
Plasmid#113967PurposeSingle short guide RNA targeting TACCACATTTGTAGAGGTTDepositorInsertsg2
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg3
Plasmid#113968PurposeSingle short guide RNA targeting CAATGTATCTTATCATGTCDepositorInsertsg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2+sg3
Plasmid#113970PurposeDouble short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn Lamp1-SYT7alpha deltaTMD
Plasmid#179722PurposeLentiviral expression of lysosome-targeted mouse Syt7DepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn Lamp1-SYT7alpha deltaTMD-HaloTag
Plasmid#179723PurposeLentiviral expression of lysosome-targeted Halo tagged mouse Syt7DepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pF(UG) U6-SYT7 sgRNA 777 HaloTag
Plasmid#179724PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITIDepositorInsertsgRNA and HaloTag
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B V304A,I367A IRES GFP
Plasmid#133821PurposeEncodes the C2B domain of synaptotagmin 1 with membrane-penetrating residue mutations V304A,I367A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationV304A, I367APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2B D363,365N IRES GFP
Plasmid#133822PurposeEncodes the C2B domain of synaptotagmin 1 with calcium-coordinating ligand mutations D363,365N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD363,365NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A K189-192A IRES GFP
Plasmid#133823PurposeEncodes the C2A domain of synaptotagmin 1 with poly-lysine patch mutations K189-192A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationK189-192APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A D230,232N IRES GFP
Plasmid#133824PurposeEncodes the C2A domain of synaptotagmin 1 with calcium-coordinating ligand mutations D230,232N for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationD230,232NPromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A M173,F234A IRES GFP
Plasmid#133825PurposeEncodes the C2A domain of synaptotagmin 1 with membrane-penetrating residue mutations M173,F234A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPMutationM173, F234APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn NS34a-msGFP-'S-mito
Plasmid#158768PurposeLentiviral expression of self-cleaving membrane targeting peptide containing the OMP25 C-terminal targeting sequence, the P6P4 NS5A/5B cleavage site, msGFP and the NS3/4A protease.DepositorInsertNS3/4a protease and msGFP
UseLentiviralMutationFlexible linkers between the protease and msGFP a…AvailabilityAcademic Institutions and Nonprofits only -
eGFP-KIF5A
Plasmid#172201PurposeExpresses KIF5A tagged with eGFP in mammalian cellsDepositorAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBa.TfR-Halo
Plasmid#162716PurposeMammalian expression of human TFRCDepositorInsertTfR (TFRC Human) (TFRC Human)
TagsHaloExpressionMammalianMutationnonePromoterChicken Beta actinAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mm-PylRS-AF/Pyl-tRNACUA
Plasmid#122650PurposetRNA synthetase/tRNA pair for the incorporation of unnatural amino acid into proteins in mammalian cells in response to the amber codon TAG.DepositorInsertPylRS-AF, Pyl-tRNACUA
TagsFLAGExpressionMammalianMutationTyrosine 306 changed to Alanine, Tyrosine 384 cha…Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-n1-APP
Plasmid#69924Purposemammalian expression of human APP fused to EGFPDepositorAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
FRB-mCherry-Giantin
Plasmid#186575PurposeExpression of FRB-mCherry on Golgi membrane with Giantin transmembrane (residues 3131-3259)DepositorAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only