We narrowed to 14,148 results for: Pol
-
Plasmid#179227Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreen and mRuby3ExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGEX-DDX21-D2+C
Plasmid#179243Purposeprotein purification in E. coliDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 HGV
Plasmid#179230Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreenExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 DAT
Plasmid#179229Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreenExpressionMammalianMutationG234D, K235APromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA M66I
Plasmid#217440PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with M66I mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA M66IAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p23-mRuby3-DDX21 HGV
Plasmid#179233Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmRuby3ExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LHP1048 - pFB-RSP5
Plasmid#32434DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV delta R8.2
Plasmid#12263PurposeFirst-generation packaging plasmid. This plasmid contains HIV accessory genes. Please reach out to your biosafety officer for guidance.DepositorInsertHIV-1 GAG/POL, Tat and Rev
UseLentiviral; PackagingExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pri1 + Pri2]-pRS403/GAL
Plasmid#241977PurposeOver-express Sc Pri1 & Pri2 (Sc pol alpha subunits) in yeast (integrated)DepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-rad30-pRS403/GAL
Plasmid#241260PurposeOver-express Sc FLAG-rad30 (Sc Pol eta) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc rev3-FLAG-pRS402/GAL
Plasmid#241258PurposeOver-express Sc rev3-FLAG (Sc Pol zeta subunit) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ec holD-pET(3c)
Plasmid#237236Purposeover-express E. coli holD (Pol III psi subunit)DepositorInsertholD (psi) (holD E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec dnaN-pET(11a)
Plasmid#237238Purposeover-express E. coli dnaN (Pol III beta sliding clamp subunit)DepositorInsertdnaN (beta) (dnaN E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holA-pET(11a)(ACH-)
Plasmid#237233Purposeover-express E. coli holA (Pol III delta subunit)DepositorInsertholA (delta) (holA E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holC-pET(3c)
Plasmid#237235Purposeover-express E. coli holC (Pol III chi subunit)DepositorInsertholC (chi) (holC E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only