We narrowed to 1,620 results for: N-pac
-
Plasmid#196683PurposeRep/Cap plasmid for the production of PAL1A, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD284
Plasmid#125073PurposeExpression of SO_4488 under PtacDepositorUseSynthetic BiologyExpressionBacterialAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD278
Plasmid#125070PurposeExpression of SO_2192 under PtacDepositorUseSynthetic BiologyExpressionBacterialMutationMutation in LacI S286L- Please see depositor comm…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS306:VN
Plasmid#37555DepositorInsertVenus N-term (aa 1-272)
ExpressionBacterialAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET28b-BE1
Plasmid#73018PurposeExpresses BE1 with N-terminal His6 tag in E. ColiDepositorInsertBE1
TagsHis6 tagExpressionBacterialPromoterT7Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB6N_RB38-Mt-tk_v8_AGKS
Plasmid#191514PurposeExpression of mitochondrial v8 ZF-DdCBE in mammalian cells (N-terminal DddAN, Right)DepositorInsertv8 ZF-DdCBE RB38-Mt-tk AGKS
ExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB7N_LT51-Mt-tk_v8_AGKS
Plasmid#191515PurposeExpression of mitochondrial v8 ZF-DdCBE in mammalian cells (N-terminal DddAC, Left)DepositorInsertv8 ZF-DdCBE LT51-Mt-tk AGKS
ExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.eB
Plasmid#103005Purposenon-standard AAV2 rep-AAV-PHP.eB cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eB VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.S
Plasmid#103006Purposenon-standard AAV2 rep-AAV-PHP.S cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.S VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO-MEF2C
Plasmid#46031DepositorAvailable SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLpA-DN.JNK1
Plasmid#51942PurposeAdenoviral vector for dominant negative JNK1 expressionDepositorInsertDN JNK1 (Mapk8 Mouse)
UseAdenoviralTagsFLAGMutationdominant negative: the dual phosphorylation moti…PromoterCMVAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLpA-DN.JNK2
Plasmid#51943PurposeAdenoviral vector for dominant negative JNK2 expressionDepositorInsertDN JNK2 (Mapk9 Mouse)
UseAdenoviralTagsHAMutationdominant negative: the dual phosphorylation moti…PromoterCMVAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD251
Plasmid#124714PurposeExpression of torS under Ptac and torT under PD59_luxRDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP89b CvTA V124N
Plasmid#141207PurposeChromobacterium violaceum transaminase with enhances affinity for PLP. TEV cleaving site after the N-terminal Histag.DepositorInsertCvTA
ExpressionBacterialMutationV124NAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV9.452sub.LUNG1
Plasmid#184592Purposenon-standard AAV2 rep-AAV9.452sub.LUNG1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification system for mouse lung transduction after intravenous injectionDepositorInsertSynthetic construct isolate AAV9.452sub.LUNG1 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC1-IMS-oROS-HT
Plasmid#216419PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the inter-membrane-space of mitochondria.DepositorInsertoROS-HT
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only