We narrowed to 49,407 results for: KAN;
-
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA4
Plasmid#204529PurposeLentiviral expression of MPL-shRNA4; gene knock down of human MPLDepositorInsertMPL-shRNA4 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA3
Plasmid#204528PurposeLentiviral expression of MPL-shRNA3; gene knock down of human MPLDepositorInsertMPL-shRNA3 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA2
Plasmid#204527PurposeLentiviral expression of MPL-shRNA2; gene knock down of human MPLDepositorInsertMPL-shRNA2 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA1
Plasmid#204526PurposeLentiviral expression of MPL-shRNA1; gene knock down of human MPLDepositorInsertMPL-shRNA1 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del18-197)-FLAG
Plasmid#204539PurposeMammalian expression of human CALR ins5 (del18-197)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del198-430)-FLAG
Plasmid#204538PurposeMammalian expression of human CALR ins5 (del198-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del367-430)-FLAG
Plasmid#204536PurposeMammalian expression of human CALR ins5 (del367-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del309-430)-FLAG
Plasmid#204537PurposeMammalian expression of human CALR ins5 (del309-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del1-308)-FLAG
Plasmid#204535PurposeMammalian expression of human CALR ins5 (del1-308)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del198-308)-FLAG
Plasmid#204540PurposeMammalian expression of human CALR ins5 (del198-308)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del1-197)-FLAG
Plasmid#204534PurposeMammalian expression of human CALR ins5 (del1-197)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del1-17)-FLAG
Plasmid#204533PurposeMammalian expression of human CALR ins5 (del1-17)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
OpenPlant kit
Plasmid Kit#1000000272PurposeStandardized DNA parts and vectors for genetic engineering of the plant synthetic biology model Marchantia polymorpha and other related plant species.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypePlant ExpressionEditing TypeCRISPRCloning TypeGolden Gate (Loop)Available SinceFeb. 6, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
ML12
Bacterial Strain#61910PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. ilvE avtA aspC genes deleted.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_dGFPmut3_ChInt
Plasmid#187388Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible destabilized GFPmut3 (containing a AAV C-terminal tail)DepositorInsertdGFPmut3_AAV
TagsAAVExpressionBacterialMutationC-terminal AAV tailAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-mTert
Plasmid#162555PurposeOverexpression of TertDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only