We narrowed to 11,815 results for: 110
-
Plasmid#110193PurposeEncodes for human CCR5 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
p181 pK7-HDAC1 (GFP)
Plasmid#11054DepositorAvailable SinceApril 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GNAI3_G-alpha
Plasmid#110014PurposeProtein expression and purification of GNAI3_G-alphaDepositorInsertGNAI3_G-alpha (GNAI3 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-OGDH_wobble
Plasmid#110938PurposeOGDH ORF containing silent wobble mutations insensitive to corresponding shRNAsDepositorInsertOGDH wobble cDNA (OGDH Human)
UseLentiviralMutation15 silent wobble mutations corresponding to three…PromoterSV40Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX-Myc-hTIM3
Plasmid#110893PurposeExpression of Myc-tagged hTIM3 at the cell surfaceDepositorInsertHepatitis A virus Cellular Receptor 2 (HAVCR2) (HAVCR2 Human)
UseRetroviralTagsMycPromoterCMVAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PTEN
Plasmid#110181PurposeExpression of PTEN tagged with EGFPDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PFN1_Profilin
Plasmid#110028PurposeProtein expression and purification of PFN1_ProfilinDepositorInsertPFN1_Profilin (PFN1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ubiquitin (1-76; T66V, L67N)
Plasmid#110755PurposeBacterial expression of human Ubiquitin (1-76; T66V, L67N)DepositorAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-FNLS-PGK-Puro
Plasmid#110847PurposeLentiviral vector for dox-inducible expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterTRE3GAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFR D770-N771 insNPG
Plasmid#11016PurposeRetroviral construct for expressing human EGFR with D770-N771 insNPG mutation in human cellsDepositorInsertEGFR D770-N771 insNPG (EGFR Human)
UseRetroviralExpressionMammalianMutationD770-N771 insNPGAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K
Plasmid#110160PurposeExpression of human eEF2K in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM260 (miniCTX1-rhaSR-PrhaBAD-stRBS-aacC1)
Plasmid#110572PurposeIntegration vector for Pseudomonas aeruginosa with rhaSR-PrhaBAD inducible promoter and StRBS-aacC1 insertDepositorInsertrhaSR-PrhaBAD-stRBS-aacC1
ExpressionBacterialPromoterrhaSR-PrhaBADAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFR (del3) L747-E749del, A750P
Plasmid#11015PurposeRetroviral construct for expressing human EGFR with L747-E749 deletion and A750P mutation in human cellsDepositorInsertEGFR (del3) (EGFR Human)
UseRetroviralExpressionMammalianMutationL747-E749 deleted, A750PAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Paf1
Plasmid#11059DepositorInsertPaf1 (PAF1 Human)
ExpressionMammalianAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCiPS-NIFV
Plasmid#110807PurposeNon-Integrating Foamy Virus pol-expressing helper plasmid with mutations in the DDE catalyic core motif of the integrase sequence, remaining as unintegated episomes in transduced cellsDepositorInsertPol
ExpressionMammalianMutation2 mutations in the DDE catalyic core motif of the…PromoterCMVAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-PBZ-VN
Plasmid#110646Purposeexpresses a PAR-binding (PBZ) domain fused to venus N-terminusDepositorInsertPBZ domain from APLF, amino acids 371-451 (APLF Human)
TagsDDK and VNExpressionMammalianPromoterCMVAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only