We narrowed to 1,795 results for: nif
-
Plasmid#83849PurposeGateway donor vector for IAA12 with no stop codonDepositorAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
10xHis-MBP-TEV-S. pyogenes dCas9 M1C D10A C80S H840A C574S
Plasmid#60815PurposedCas9 with single cysteine residue (M1C) for site-specific labellingDepositorInsertdCas9 M1C D10A C80S H840A C574S
TagsHis10 and MBPExpressionBacterialMutationM1C D10A C80S H840A C574SAvailable SinceDec. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
E-cadherin-GFP
Plasmid#28009DepositorAvailable SinceMarch 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Sec23A
Plasmid#166893Purposemammalian expression of Sec23A tagged with mEmeraldDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM3_Euk_2NLS-Flex-Cas12a (LbCas12a)-2NLS
Plasmid#244838PurposeMammalian expression of Flex-Cas12a with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertFlex-Cas12a
UseCRISPRTags2xSV40 NLSExpressionMammalianMutationG146R/R182V/D535G/S551F/D665N/E795QPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-VSVG
Plasmid#11912DepositorInsertVSVG
ExpressionMammalianMutationF64L, S65T, A206K relative the wild type GFP sequ…Available SinceSept. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMBP-LbCas12a
Plasmid#113431PurposeExpresses 10xHis-MBP fused to LbCas12aDepositorHas ServiceCloning Grade DNAInsertLbCas12a
TagsMBPExpressionBacterialPromoterT7Available SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-B2M-miniGag-Cas9
Plasmid#228958PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH029
Plasmid#171060PurposePlasmid for expressing Gag fused to spyCas9-3x FLAG-2x SV40 NLS with the SQNYPIVQ HIV-1 cleavage site in betweenDepositorInsertGag-spyCas9
UseCRISPR and LentiviralTags2x SV40 NLS and 3x FLAG tagExpressionMammalianPromoterCAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-noPS
Plasmid#177943PurposeTransient mammalian expression of eGFP. Lacks packaging sequence and is used as a negative control transfer plasmid for SARS-CoV-2 virus-like particles.DepositorInserteGFP
ExpressionMammalianAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2CT-His-MBP-Lbu_C2c2_R472A_H477A_R1048A_H1053A
Plasmid#83485PurposeBacterial expression of L. buccalis C2c2 CRISPR effector (double HEPN nuclease 1 and 2 inactive mutant).DepositorInsertLbu_C2c2_R472A_H477A_R1048A_H1053A
UseCRISPRTagsHis6-MBPExpressionBacterialMutationR472A, H477A, R1048A, H1053AAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
L0-I35 p35S-XVE-pEstradiol GG0-GG1
Plasmid#195904PurposeLevel 0 inducibile estradiol promter and XVE activator protein (p35S-XVE gene-tRBCS-tNOS-LexA-p35S with GG0 and GG1 golden gate linkers)DepositorInsertp35S-XVE-LexA-p35S
UseSynthetic BiologyAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT-WT-Myc
Plasmid#177717PurposeER protein alpha-1-antitrypsin (WT), myc taggedDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only