We narrowed to 1,730 results for: Tyr
-
Plasmid#121502PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCI-Myc3-HPS4
Plasmid#133931PurposeExpresses 3xMyc-HPS4 construct in mammalian cellsDepositorInsertHPS4 (HPS4 Human)
Tags3xMyc tagExpressionMammalianMutationGlutamic acid 229 to Glycine; Valine 552 to Methi…PromoterCMV I.E.Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-GABARAPL1 G116
Plasmid#123119PurposeExpresses EGFP-GABARAPL1 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-Src Y527E
Plasmid#246428PurposeExpresses Src mutant Y527E (aka Y530E) in Mammalian cellsDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-Src Y527A
Plasmid#246429PurposeExpresses Src mutant Y527A (aka Y530A) in Mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_AnapRS
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
ExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-muhCD4
Plasmid#162745PurposeNFAT-driven ZsGreen-1 reporter gene with mutated human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianMutationHuman CD4 gene with glutamine to tyrosine at posi…Available SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-mCherry
Plasmid#118272PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-v2 RsTAL At4CL
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsTagsHisExpressionBacterialPromoterT7Available SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PM-RA-BlastR
Plasmid#211708PurposeLentiviral expression of a ddFP subunit (RA) fused with the lipid modification motif of lymphocyte-specific protein tyrosine kinase (Lck) for plasma membrane (PM) targetting (PM-RA)DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag
Plasmid#155012PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianPromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-PTPRD-WT
Plasmid#25642DepositorInsertProtein tyrosine phosphatase receptor-type delta (PTPRD Human)
UseLentiviralExpressionMammalianMutationAn NsiI restriction site was engineered into the …Available SinceApril 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB2
Plasmid#200982PurposeMammalian expression plasmid for myc-tagged EphB2DepositorInsertEphB2 (EPHB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cSrc
Plasmid#214233PurposeBacterial expression of the kinase domain of cSrc with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-GFP
Plasmid#118270PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-Y1699C
Plasmid#25048DepositorAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only