We narrowed to 14,447 results for: cas9 genes
-
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335A_hCas9(D10A)_IRF8gRNA2
Plasmid#89720PurposeKnockout IRF8 in human cellsDepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#2
Plasmid#107727PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-Gsk3b(new)
Plasmid#122341PurposeExpresses sgRNA targeting mouse Gsk3b and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Gsk3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti Cas9/SB100
Plasmid#155294PurposeLentiviral expression of Cas9 and SB100DepositorInsertSB100X-P2A-spCas9
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBLO43.3.-6_human ProCas9Flavi-6
Plasmid#121630PurposeU6-sgRNAdest_CMV-intron_hProCas9Flavi-6_T2A Mcherry_AmpR_ColE1DepositorTypeEmpty backboneExpressionMammalianPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS1026-pMCSG7-HpaCas9
Plasmid#121540PurposeExpresses a 6X-His tagged type II-C Cas9 from H. parainfluenzae in bacterial cellsDepositorInsertHpaCas9
ExpressionBacterialAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
ciCas9(L22)_pcDNA5
Plasmid#100551PurposeExpresses ciCas9(L22) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.DepositorInsertciCas9(L22)
UseCRISPR; Frt, flp-inTagsFLAGExpressionMammalianAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2301y-tdtomato-dCas9_DegronDead_TPLN188
Plasmid#205409PurposedCas9 guided repressorDepositorInsertdCas9_DegronDead_TPLN188
ExpressionPlantAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1027-pMCSG7-SmuCas9
Plasmid#121541PurposeExpresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cellsDepositorInsertSmuCas9
ExpressionBacterialAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Cas9-RFC5
Plasmid#183200PurposeEntry cloneDepositorInsertCas9-RFC5
UseCRISPR; Gateway entry cloneMutationn/aAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15546_nABE8e-SuperFi-Cas9
Plasmid#184376PurposeMammalian expression of SuperFi-Cas9 ABE8e base editorDepositorInsertnABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9
Plasmid#130968Purpose3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-SpCas9
UseCRISPRTags3x HA, EGFP, and NLSExpressionMammalianPromoterCbhAvailable SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-TUBA1B_sgRNA
Plasmid#183889PurposepX459V2.0-HypaCas9 plasmid with TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
A3D-Cas9n-UGI
Plasmid#119137PurposeBase editor made from APOBEC3DDepositorInsertAPOBEC3D-Cas9 nickase-UGI
UseCRISPRMutationNonePromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
V1-MESA-45F-M-dCas9
Plasmid#84504PurposeMESA target chain with V1-MESA ectodomain, 45 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
ciCas9(F22)_pcDNA5
Plasmid#100552PurposeExpresses ciCas9(F22) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.DepositorInsertciCas9(F22)
UseCRISPR; Frt, flp-inTagsFLAGExpressionMammalianAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV dCas9-MC (eGFP)
Plasmid#89931PurposeExpresses the dCas9-MC fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertdCas9-MC
TagsFlagExpressionMammalianMutationdeactivated Cas9, fragment of M.SssI (residues 27…PromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only