We narrowed to 5,291 results for: crispr cas9 expression plasmids
-
Plasmid#124772Purpose3rd generation lentiviral plasmid to co-express a guide RNA and mOrangeDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pEG302 22aa SunTag NtDRMcd g4+g10+g18 (FWA)
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSPDEF.1.0-gDNA
Plasmid#113796PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SPDEFDepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF423.1.0-gDNA
Plasmid#113790PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF423DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNFXL1.1.0-gDNA
Plasmid#112451PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NFXL1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTEAD1.1.0-gDNA
Plasmid#112425PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TEAD1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pERF.1.0-gDNA
Plasmid#112395PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ERFDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS260
Plasmid#73685PurposePunc-17::2xNLS-FLP-D5 Expression vectorDepositorInsertPunc-17::2xNLS-FLP-D5::let-858 3'-UTR
UseFlp/frtExpressionWormMutationG5DPromoterPunc-17Available SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS360
Plasmid#73687PurposePunc-47::2xNLS-FLP-D5 Expression vectorDepositorInsertPunc-47::2xNLS-FLP-D5::let-858 3'-UTR
UseFlp/frtExpressionWormPromoterPunc-47Available SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
KB601: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121819PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pE2F3.3.1-gDNA
Plasmid#113776PurposeCRISPR plasmid for expression of Cas9 nickase (D10A) and gRNA targeting human transcription factor E2F3DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 nog
Plasmid#115480PurposeCRISPR-Cas9 SunTag system to target VP64 to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_NLS_linker_VP64_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only