We narrowed to 2,724 results for: gem
-
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker(A6TAG)-3xFLAG KI
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K468TAG)
Plasmid#182663PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K468 and an N-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a K468TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK468TAGPromoterCMVAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K227R-HA
Plasmid#139859PurposeLentiviral expression of human DDRGK1-K227R-HADepositorAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K121R-HA
Plasmid#139852PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K116R-HA
Plasmid#139850PurposeLentiviral expression of human DDRGK1-K116R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K120R-HA
Plasmid#139851PurposeLentiviral expression of human DDRGK1-K120R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K124R-HA
Plasmid#139853PurposeLentiviral expression of human DDRGK1-K124R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K128R-HA
Plasmid#139854PurposeLentiviral expression of human DDRGK1-K128R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K146R-HA
Plasmid#139855PurposeLentiviral expression of human DDRGK1-K146R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K176R-HA
Plasmid#139856PurposeLentiviral expression of human DDRGK1-K176R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K193R-HA
Plasmid#139857PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K224R-HA
Plasmid#139858PurposeLentiviral expression of human DDRGK1-K224R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-2
Plasmid#109006PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-mCherry-Eea1[36-126]-mCherry
Plasmid#246260PurposeRab5 sensor acceptorDepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mCherry-FYCO1[963-1206]-mCherry
Plasmid#246264PurposeRab7 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
Plasmid#35504PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only