We narrowed to 3,492 results for: aaas
-
Plasmid#169845PurposeExpress a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.DepositorInsertsgCTNNB1 Nicking (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-SRSF1 siRNA-resitant
Plasmid#218974PurposeVector for expressing siRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)DepositorInsertSRSF1 cDNA
ExpressionMammalianMutationsiRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGG…PromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001148426)
Plasmid#75545Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001147821)
Plasmid#76112Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-Anillin shRNA
Plasmid#187270PurposeLentiviral expression of shRNA targeting AnillinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna5-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128340PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001146967)
Plasmid#76534Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_sh_ex15
Plasmid#35166DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2201
Plasmid#115449PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIK2 gRNA (BRDN0001147148)
Plasmid#77140Purpose3rd generation lentiviral gRNA plasmid targeting human SIK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146019)
Plasmid#75540Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK2 gRNA (BRDN0001146615)
Plasmid#77569Purpose3rd generation lentiviral gRNA plasmid targeting human PAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001146241)
Plasmid#76467Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCB gRNA (BRDN0001144990)
Plasmid#75955Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PBK gRNA (BRDN0001147308)
Plasmid#75574Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only