We narrowed to 7,670 results for: URE
-
Plasmid#154272PurposeBacterial expression of full length human OGT with K842M mutation (catalytically inactive). N-terminal T7_leader-8xHis tag followed by HRV3C protease site.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags8x His, HRV3C protease site, and T7 leaderExpressionBacterialMutationLysine 842 changed to Methionine- bacterial codon…Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
hRAD18 dSAP-EGFP
Plasmid#68825PurposeExpresses human RAD18 (deleting SAP domain) tagged with EGFPDepositorInserthuman RAD18 (deleting SAP domain) tagged with EGFP (RAD18 Human)
ExpressionMammalianAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
B1-1
Plasmid#111463PurposeVal-tRNA synthetaseDepositorInsertVal-tRNA synthetase
Tags6xHisExpressionBacterialAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1-C160S
Plasmid#85666PurposeExpression of human YOD1 C160S mutant with N-terminal GFP tagDepositorAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-rox-STOP-rox-tRFP-pA-lox-ZsGreen-pA
Plasmid#175438Purposedual plasmid labelling cells of different neuronal population with different fluorophoresDepositorInsertrox-STOP-rox-tRFP-pA
UseCre/Lox; Dre/roxTagsZsGreen on backboneExpressionMammalianPromoterpCAGAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-dHer1cys
Plasmid#73218PurposeBacterial expression vector for Z1907 affibody protein (A) with N-terminal His10, GST and HRV3C cleavage site (cysteine tag)DepositorInsert10XHis-GST-HRV-dHer1cys
Tags10XHis-GST-HRV and The dimer of the Her1 Affibody…ExpressionBacterialPromoterT7Available SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
RF18
Bacterial Strain#102802PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. aspC tyrB ilvE avtA genes deleted.DepositorBacterial ResistanceNoneAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB223
Plasmid#164127PurposeNew measurement standardDepositorInsertYFP-PP7
ExpressionBacterialPromoterJ23101Available SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-mScarlet
Plasmid#140875PurposeMultisite Gateway middle entry vector for fusing mScarlet to the 3' end of an ORF.DepositorInsertmScarlet
UseGateway CloningAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQ2aB
Plasmid#124887PurposeBasic Retroviral backbone with multiple 2a sites, linkers, BFP and and IRES_puromycin from pQCXIPDepositorTypeEmpty backboneUseRetroviralTagsBlue Flourescent Protein, FlagExpressionMammalianPromoterCMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
p307HU
Plasmid#27386DepositorInsertunligated form of ligase ribozyme
ExpressionBacterialAvailable SinceJan. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1
Plasmid#46670DepositorInserthsa-let-7a-1 (MIRLET7A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHRSin_hCD3δ-GFP2
Plasmid#187355PurposeLentiviral expression of truncated hCD3 delta-GFP2DepositorInsertTruncated hCD3 delta, and GFP2
UseLentiviralPromoterSFFVAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-ATP
Plasmid#184599PurposeFor expression of a fluorescent sensor for ATP in mammalian cellsDepositorInsertMTRIA-ATP
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJYDN2
Plasmid#162454PurposeYeast display plasmid intended for co-cultivation labeling by using designed ALFA-tag binding nanobody (DnbALFA) and expression of N-terminal fusions with Aga2p yeast agglutinin.DepositorTypeEmpty backboneUseShuttle vector bacteria/yeastTagsDnbALFA nanobody and Ha and mycAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-CDS
Plasmid#136057PurposeUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK164
Plasmid#13533DepositorInsertFLIPW-CTY
TagsECFP and VenusExpressionBacterialAvailable SinceJuly 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-pGC-A
Plasmid#186626PurposepFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)DepositorInsertNPR1 (NPR1 Human)
Tagshemagglutinin (HA) signal peptide + His10-tag + T…ExpressionInsectMutationdeleted amino acids 1-32PromoterpolyhedringAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only