We narrowed to 37,743 results for: Ran;
-
Plasmid#124137PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCMV5 Smad1-HA
Plasmid#14956DepositorAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag MKK4(glu)
Plasmid#14813DepositorAvailable SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 WT B-Myb
Plasmid#25965DepositorInsertB-Myb (MYBL2 Human)
ExpressionMammalianAvailable SinceAug. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NL1AB
Plasmid#15262DepositorAvailable SinceJan. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-FLp300
Plasmid#61356Purposeencodes S. pyogenes dCas9 with c-terminal fusion of FL human p300 (aa 2-2414) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal full length human p300 (aa 2-2414) (EP300 Synthetic, Human, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX TIF1gamma
Plasmid#15734DepositorAvailable SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pL3-TRE-LucGFP-2L
Plasmid#11685DepositorInsertLuciferase-EGFP
UseCre/LoxExpressionMammalianAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDDGFP_LEU2D
Plasmid#58352PurposeUsed for expressing recombinant proteins as a C terminal GFP-His tagged constuct in S.cerevisiaeDepositorTypeEmpty backboneTagsGFP-HisExpressionYeastPromoterGAL1Available SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-RhoB
Plasmid#23225DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBABE-zeo smallT
Plasmid#8583DepositorAvailable SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
PKC delta CAT
Plasmid#16388DepositorInsertPKC delta (Prkcd Mouse)
TagsHAExpressionMammalianMutationCAT: catalytic domain, aa 334-674Available SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP8
Plasmid#18066DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTNS1
Plasmid#64967PurposeTn7 transposase expressionDepositorInserttnsABCD
Available SinceOct. 23, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10-VEGFprom(-1000 to -1)
Plasmid#66128PurposeLuciferase-based reporter for VEGF promoter region (-1000 to -1 bp)DepositorInsertVascular Endothelial Growth Factor -A promoter region (VEGFA Human)
UseLuciferasePromoterVEGF -1000 to -1Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/HIS/FLAG/HA-PRDX1
Plasmid#38086DepositorAvailable SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYPQ150
Plasmid#69301PurposeGateway entry vector with pcoCas9 (Plant codon optimized)DepositorInsertpcoCas9 (plant codon-optimized)
UseCRISPRTags3XFLAGMutationNLS fusionAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAluYa5-neo-TET
Plasmid#51283Purposeexpresses Alu, a human SINE, using the pol III enhancer sequence of the 7SL gene and tagged with the self splicing intron neo cassetteDepositorInsertAluYa5
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoterupstream pol III enhancer sequence of the 7SL gen…Available SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only