We narrowed to 4,522 results for: ARA-2
-
Viral Prep#98929-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn.iGluSnFr.WPRE.SV40 (#98929). In addition to the viral particles, you will also receive purified pAAV.hSyn.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 27, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98931-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98931-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98932-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (AAV5)
Viral Prep#98931-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 (#98931). In addition to the viral particles, you will also receive purified pAAV.hSyn.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent, iGluSnFr glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV1)
Viral Prep#98932-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (AAV9)
Viral Prep#98932-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 (#98932). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent glutamate sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-cyto-GCaMP6f (AAV5)
Viral Prep#52925-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1 gfaABC1D-cyto-GCaMP6f (#52925). In addition to the viral particles, you will also receive purified pZac2.1 gfaABC1D-cyto-GCaMP6f plasmid DNA. gfaABC1D-driven (similar to GFAP promoter) cyto-GCaMP6f calcium sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP (AAV1)
Viral Prep#117383-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-TRE-DIO-eYFP (#117383). In addition to the viral particles, you will also receive purified pAAV-TRE-DIO-eYFP plasmid DNA. Tet-inducible, Cre-dependent eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTRETagseYFP (Tet-inducible, Cre-dependent)Available SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV Retrograde)
Viral Prep#117382-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV PHP.eB)
Viral Prep#117382-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV Retrograde)
Viral Prep#104055-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV PHP.eB)
Viral Prep#104055-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-GFP (AAV PHP.eB)
Viral Prep#104061-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-NLS-GFP (#104061). In addition to the viral particles, you will also receive purified pAAV-CAG-NLS-GFP plasmid DNA. CAG-driven NLS-GFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO eNpHR 3.0-EYFP (AAV Retrograde)
Viral Prep#26966-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-DIO eNpHR 3.0-EYFP (#26966). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO eNpHR 3.0-EYFP plasmid DNA. EF1a-driven, cre-dependent eNpHR 3.0-EYFP for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-FHA-SHLD2-m1
Plasmid#114122PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-RNF8 FHA domain-SHLD2, m1 mutant; 53BP1-independent recruitment to damaged chromatinDepositorInsertSHLD2 (m1 mutant) (SHLD2 Human)
UseLentiviral; Doxycycline inducibleTagsRNF8 FHA domain (aa 2-160) and eGFPExpressionMammalianMutationW489A, F494A, W495A mutations introducedPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
AcGFP-PMS2
Plasmid#215124PurposeExpresses AcGFP-PMS2 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-WzxE-TEV-His10
Plasmid#226781PurposeExpression of C-terminally TEV cleavable His10-tagged WzxE from E. coli in E. coliDepositorInsertwzxE
TagsTEV cleavable 10xHistidine tagExpressionBacterialMutationvaline insertion in position 2 due to the cloning…PromoteraraBADAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-APT2-LaG16-3W
Plasmid#234425PurposeExpress APT2 with a mutated non-binding anti-GFP nanobody LaG16 (F30W, T55W, G103W) fused at the C terminus separated by a flexible linkerDepositorInsertAPT2 fused to non-binding mutant LaG16 (LYPLA2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
Plasmid#200400PurposeExpresses DsRed broadly, expresses QF2 and GCaMP6s in OSNs of the clonal raider antDepositorInsertsDiscosoma red fluorescent protein
Q factor 2
GCaMP6s
ExpressionInsectPromoter15x QUAS, ObirOrco (Oocearaea biroi Orco promoter…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
S17-1λpir gyrAR462C
Bacterial Strain#237425PurposeThis engineered E. coli S17-1 λpir strain, featuring a mutation in the gyrA gene (462Arg→Cys), was designed to confer resistance to the CcdB toxin, allowing it to survive with a ccdB-carrying plasmid.DepositorBacterial ResistanceNoneAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-RhoA/N12-RhoA/13C(Q63L)-FKBP-mVenus-CAAX
Plasmid#214282PurposeExpress split-RhoA fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationRhoA-Q63LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G (AAV1)
Viral Prep#52473-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (AAV5)
Viral Prep#35509-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (#35509). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin E123T/T159C mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (AAV9)
Viral Prep#35509-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP (#35509). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin E123T/T159C mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP (AAV PHP.V1)
Viral Prep#104052-AAVPHP.V1PurposeReady-to-use AAV PHP.V1 particles produced from pAAV-CAG-DIO-EYFP (#104052). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-EYFP plasmid DNA. CAG-driven, Cre-dependent expression of EYFP. These AAV were produced with the PHP.V1 serotype, which permits efficient transduction of brain vascular cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NCOA4_RET
Plasmid#205865PurposeExpress mEGFP-tagged fusion protein, NCOA4_RET from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NSD1_ZNF346
Plasmid#205870PurposeExpress mEGFP-tagged fusion protein, NSD1_ZNF346 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218110-rAbPurposeAnti-Rhodopsin chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds to TETSQVAPA sequence.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
BATF-GFP HDRT Source (pTR 146)
Plasmid#112015PurposeDNA sequence source for amplifying an HDR template to tag endogenous human BATF gene with GFPDepositorInsertBATF-GFP HDRT (BATF Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX304-EZH1-D745N
Plasmid#203585PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Aspartic Acid 745 to Asparagine for parti…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-flag-RAP1B-N17-puro
Plasmid#156169PurposeLentiviral vector for expression of flag-RAP1B-N17, with puromycin selectionDepositorInsertRAP1B (RAP1B Bovine)
UseLentiviralTags2xFLAGExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP2A-N17-puro
Plasmid#156172PurposeLentiviral vector for expression of RAP2A-N17, with puromycin selectionDepositorInsertRAP2A (RAP2A Human)
UseLentiviralTagsnoneExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214278PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-Q61LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Cdc42/N12-Cdc42/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214279PurposeExpress split-Cdc42 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationCdc42-T17NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(Q61L)-FKBP-mVenus-CAAX
Plasmid#214280PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationRac1-Q61LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214281PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRac1-T17NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-RhoA/N12-RhoA/13C(T19N)-FKBP-mVenus-CAAX
Plasmid#214283PurposeExpress split-RhoA fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (on…ExpressionMammalianMutationRhoA-T19NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218108-rAbPurposeAnti-Protein C tag chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds to EDQVDPRLIDGK sequence.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
CL20_mEGFP_NUP98_NSD1
Plasmid#205873PurposeExpress mEGFP-tagged fusion protein, NUP98_NSD1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV9)
Viral Prep#113050-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m (AAV9)
Viral Prep#113049-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1m (#113049). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1m plasmid DNA. Synapsin-driven expression of GRAB-DA1m dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0 (AAV9)
Viral Prep#121922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_ACh3.0 (#121922). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_ACh3.0 plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha2-EGFP
Plasmid#160976PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform alpha2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV5)
Viral Prep#100054-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV9)
Viral Prep#100054-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (AAV1)
Viral Prep#100054-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only