We narrowed to 16,291 results for: grna
-
Plasmid#213781PurposeExpresses CRISPRa gRNA for CD40 promoter and mScarlet. gRNA driven by mU6.DepositorInsertSa gRNA
UseCRISPR and LentiviralPromotermU6Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RACK1
Plasmid#127123DepositorInsertgRNA RACK1 (RACK1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7EGFPgRNA
Plasmid#46760DepositorInsertegfp target
UseCRISPRPromoterT7Available SinceAug. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_2
Plasmid#155105Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7sgRNA
Plasmid#111820PurposeExpresses sgRNA in T. brucei cellsDepositorInsertsgRNA
UseCRISPRAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP1_G1
Plasmid#127114DepositorInsertgRNA G3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNAy
Plasmid#168294PurposeExpresses gRNA targeting the yellow gene in DrosophilaDepositorInsertU6.3-gRNA[y]-scaffold
ExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7tyrgRNA
Plasmid#46761DepositorInserttyr gRNA (tyr Zebrafish)
UseCRISPRAvailable SinceAug. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC_sgRNA
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceSept. 14, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgRNA.SFFV.GFP
Plasmid#169938PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and GFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBP_sgRNA
Plasmid#190128PurposeLevel 0 MoClo plasmid for Golden Gate cloning of sgRNAsDepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_v2_Dual_epegRNA_tevopreQ1
Plasmid#187456PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4_v2 optimized epegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R_v2 epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter1_SP-2x
Plasmid#79370PurposeAssays activity of transcriptional activators fused to SP Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceApril 8, 2017AvailabilityAcademic Institutions and Nonprofits only