We narrowed to 7,159 results for: GFP expression plasmids
-
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHL047 [15ARE23bp -p(TATA)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246422PurposeFirefly luciferase driven by an AHR responsive minimal promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37a +SV40 base prom-GFP-IRES-AP
Plasmid#225889PurposeEnhancer reporterDepositorInsertmR0-37a
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17c +SV40 base prom-GFP-IRES-AP
Plasmid#225890PurposeEnhancer reporterDepositorInsertmR3-17c
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17d +SV40 base prom-GFP-IRES-AP
Plasmid#225891PurposeEnhancer reporterDepositorInsertmR3-17d
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1
Plasmid#83900PurposeGFP expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserteGFP
UseAAVPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
VI_pAAV-ProA7-GFP-WPRE
Plasmid#125891PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProA7Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
VII_pAAV-ProB8-GFP-WPRE
Plasmid#125928PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProB8Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV/mIba1.GFP.miR-9.T.miR-129-2-3p.T.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA
Plasmid#226475PurposeImproved microglia-targeted transgene expressionDepositorInsertsmIba1 promoter, 1.7-kb, microglia-specific promoter
target sequences for miR-9x4 & miR-129-2-3px4 *2
EGFP
UseAAVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
1095=Rcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159673PurposePlasmid supports Cas9 expression in both males and females, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertRcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQY527A-IRES-mCherry
Plasmid#166951PurposeLentiviral plasmid expressing GFP-tagged SFPQ Y527A protein with IRES-mCherry from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsGFP and mCherryMutationSFPQ-Y527APromotereF1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EZH2-PGK-Puro-IRES-GFP
Plasmid#75125PurposeRetroviral expression plasmid encoding wild type human EZH2DepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP-P2A-bReaches-minWPRE
Plasmid#118276PurposeExpresses EGFP and bReaChES under a minimal CamKII PromoterDepositorInsertsEGFP
bReaCHES
UseAAVTagsP2APromoterCamK IIAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR del52-FLAG
Plasmid#204523PurposeRetroviral expression of human CALR del52-FLAGDepositorAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9-PGK-Puro-IRES-GFP
Plasmid#75114PurposeRetroviral expression plasmid encoding wild type human BRD9DepositorInsertBRD9 (BRD9 Human)
UseRetroviralAvailable SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR ins5-FLAG
Plasmid#204524PurposeRetroviral expression of human CALR ins5-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Cterm_3xFL_BRD9-PGK-Puro-IRES-GFP
Plasmid#75122PurposeRetroviral expression plasmid encoding wild type human BRD9 with a C terminal 3x FLAG-tagDepositorAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_dBD-PGK-Puro-IRES-GFP
Plasmid#75115PurposeRetroviral expression plasmid encoding a human BRD9 mutant lacking the bromodomainDepositorAvailable SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Myc-PGK-Puro-IRES-GFP
Plasmid#75124PurposeRetroviral expression plasmid encoding wild type murine MycDepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRD7BD-PGK-Puro-IRES-GFP
Plasmid#75118PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRD7 bromodomainDepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_N216A-PGK-Puro-IRES-GFP
Plasmid#75116PurposeRetroviral expression plasmid encoding a human BRD9 mutant carrying the N216A single amino acid mutationDepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BET-PGK-Puro-IRES-GFP
Plasmid#75120PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the first bromodomain of BRD4DepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRG1BD-PGK-Puro-IRES-GFP
Plasmid#75121PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRG1 bromodomainDepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRD1BD-PGK-Puro-IRES-GFP
Plasmid#75119PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRD1 bromodomainDepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-Flex-GFP-Fishell_6
Plasmid#83895PurposeCre recombinase-dependent GFP expression in forebrain GABA-ergic interneurons under the control of the hDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV8, and AAV9InserteGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1-2a-EGFP ferritin
Plasmid#79649PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1Mutant-2a-EGFP ferritin
Plasmid#79650PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 with mutant pore region and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianMutationisoleucine 679 changed to lysinePromoterCMVAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-3xGFP
Plasmid#191204PurposeFlpO dependent GFP expressionDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKIIa(0.4)-PdCO-EGFP-WPRE
Plasmid#198514PurposeExpresses optimized PdCO in frame with EGFP under control of minimal CamKIIa promotor.DepositorInsertPdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
retro-gfpIkkb-puro vector
Plasmid#58251PurposeRetroviral expression vector encoding bicistronic EGFP-IKKbeta and Puromycin cassetteDepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only