We narrowed to 7,149 results for: cas9 plasmid
-
Plasmid#107889PurposeW1.0.1 plasmid. Contains PTetO-SD8-Cas9, PLac-sgRNA1 and is part of CAMERA 1.0.1DepositorInsertPTetO-SD8-Cas9, PLac-sgRNA1
ExpressionBacterialAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWT007g
Plasmid#107890PurposeW1.0.2 plasmid. Contains PTetO-sd2-Cas9, PLac-sgRNA1 and is part of CAMERA 1.0.2DepositorInsertPTetO-sd2-Cas9, PLac-sgRNA1
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-RB-PE2
Plasmid#173903PurposeSB-transposon with inducible expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only