We narrowed to 3,228 results for: Streptococcus
-
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDNR-SpCas9-Cdt1
Plasmid#80426PurposeUsed for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle.DepositorInsertSpCas9-Cdt1
UseCRISPRTagsCdt1Mutationcodon optimized for humanAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIntegrase_10
Plasmid#60581Purposeplasmid contains the integrase gene under the control of the arabinose-inducible promoter, PbadDepositorInsertIntegrase_10
ExpressionBacterialMutationCodon optimized for E.coliPromoterpBADAvailable SinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIntegrase_3
Plasmid#60575Purposeplasmid contains the integrase gene under the control of the arabinose-inducible promoter, PbadDepositorInsertIntegrase_3
ExpressionBacterialMutationCodon optimized for E.coliPromoterpBADAvailable SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PEmaxdeltaRNaseH-dualU6-Rosa26-twinPE-attB
Plasmid#207859PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pE-35S-miniSdd7-nCas9-PBE-GmPPO2
Plasmid#204855PurposeFor cytosine base editing using miniSdd7 at PPO2 site in soybean (Agrobacterium-mediated transformation)DepositorInsertminiSdd7-nSpCas9(D10A)-UGI-mScarlet
UseCRISPRExpressionPlantMutationD10A in SpCas9Promoter35S, AtU6-26pAvailable SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
AD59_pEP.DonorCLYBL.TS
Plasmid#199227PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for PuroR.T2A.EGFP selectable and reporter markers
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
modRNAc0-Cas9-2A-GFP
Plasmid#170181PurposeIVT template plasmid for making modified Cas9GFP RNADepositorInsertCas9-2A-GFP
UseIvt template plasmidPromoterT7 promoterAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCas9-P2A-BFP
Plasmid#149447PurposeExpresses Cas9 and BFP in a lentiviral vector.DepositorInsertP2A-BFP
UseLentiviralTagsFLAGExpressionMammalianPromoterIn frame with Cas9Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BC1209-pHR-dSV40-dCas9-14xGFP11-P2A-BFP
Plasmid#164038PurposeExpression of dCas9-14xGFP11 in mammalian cellsDepositorInsertdCas9-14xGFP11
UseCRISPR and LentiviralExpressionMammalianMutationD10A and H840A in Cas9PromoterdSV40Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM65879
Plasmid#153214PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and Bar selection cassetteDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_sgRNA-ver2
Plasmid#126776PurposegRNA expression vector with mCherry transfection control, does not contain the direct repeat of the truncated guideRNADepositorInsertsgRNA (for SpCas9)
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL032
Plasmid#137901PurposeSTU2.0 LbCas12a for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA(lib)-puro
Plasmid#119976PurposeLenti sgRNA cloning backbone with CMV-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
nos-Cas9.874Z1
Plasmid#112685PurposeExpress hSpCas9 under nanos promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoternanosAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only