31,059 results
-
Plasmid#118542PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertsYFP2
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBEI-6410
Plasmid#47049PurposeBglBrick plasmid (=pBbA5a-MTSAe-T1f-MBI(f)-T1002i-Ptrc-trGPPS(co)-LS) coding for MEV pathway enzymes to produce limonene from glucose in E. coliDepositorInsertCodon-optimized sequences for MEV pathway expression in E. coli to produce limonene
UseSynthetic Biology; BglbrickExpressionBacterialPromoterPlacUV5Available SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
TOPO mCherry
Plasmid#68490PurposeTOPO construct expressing mCherry for generation of GMAP-compatible geneDepositorInsertmCherry
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBsacA
Plasmid#158650PurposeConstitutive transcription of sacA crRNADepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-Rad23A_pET11a
Plasmid#169124Purposeexpression of proteinDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPT234
Plasmid#127855PurposeRepressilator 2.0, without degradation tags, integrated triple reporterDepositorInsertsbla
mSCFP3
mKate2
mVenus
TetR
LacI
cI
UseSynthetic BiologyExpressionBacterialMutationFirst 11aa derived from mCherry as fusion proteinPromoterpAmpR, pL LacO1, pL tetO1, and pRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACM4
Plasmid#49797PurposeePathBrick vector for pathway engineering in E. coli.DepositorTypeEmpty backboneTagsS-tagExpressionBacterialPromoterT7Available SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
XX01CAPN2A-c001
Plasmid#175492PurposeProtein expression in bacterial cells. Entire CDS, M1-L700 (CAPN2); EF hand 1-5, H86-S268 (CAPNS1). CAPN2 can be biotinylated. Codon optimised.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP2846
Plasmid#160676PurposeMobile CRISPRi empty sgRNA (BsaI) for cloning new sgRNAsDepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMVV102
Plasmid#215308PurposeExpresses sfGFP under induction with the IPTG Marionette Cassette (LacIAM + PTac-sfGFP) with a BBR1 backbone.DepositorInsertsfGFP
UseSynthetic BiologyTagsNoneExpressionBacterialPromoterPTacAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMVV103
Plasmid#215309PurposeExpresses sfGFP under induction with the aTc Marionette Cassette (TetR + PTet-sfGFP) with a BBR1 backbone.DepositorInsertsfGFP
UseSynthetic BiologyTagsNoneExpressionBacterialPromoterPtetAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn5-164
Plasmid#118544PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmOrange2
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn5-166
Plasmid#118546PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmCardinal
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Alpha1
Plasmid#118044PurposeGoldenBraid2.0 Alpha 1 destination vectorDepositorTypeEmpty backboneUseSynthetic Biology; Assembly of gb2.0 transcriptio…ExpressionBacterial, Insect, and Mamm…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX Su(fu) (CT#99)
Plasmid#13856DepositorInsertSu(fu) (SUFU Chicken)
TagsGSTExpressionBacterialMutationNco I fragment from full length; ~2kbp- ATG to st…Available SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC18/promEco/Lysostaphin
Plasmid#125765PurposeProduction of staphylolytic protein lysostaphin from a constitutive promoterDepositorInsertlysostaphin
ExpressionBacterialMutationsequence corresponding to the mature form proteinPromoterpemIK-Sa1 promoterAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
His-PIMT
Plasmid#34852DepositorAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
keratin 8 (krt8)-H2B-RFP
Plasmid#105955PurposetransgenesisDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only