32,967 results
-
Plasmid#145352PurposeCell-free expression vector for Zika virus NS1 protein with C-term mCherryDepositorInsertZIKV NS1
TagsmCherry and 8xHisExpressionBacterialPromoterT7Available SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-NDFIP2
Plasmid#179330PurposeE. coli optimized expression of GST-fusion of human NDFIP2DepositorAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJC175e-DddI
Plasmid#179693PurposeMutagenesis plasmid with constitutive bacterial expression of DddI immunity proteinDepositorInsert[SD8] gIII
ExpressionBacterialAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-POLI-ST2-com vector
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpH-HsBTG2_1-128opt_AF
Plasmid#148656PurposeBacterial Expression of HsBTG2_1-128optDepositorInsertHsBTG2_1-128opt (BTG2 Human)
ExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIT5_KH
Plasmid#173772PurposeBacterial genomic integration vectorDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_KEAP1_KELCH
Plasmid#178496PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_TNKS_TANK-peptide-bind
Plasmid#178489PurposeBacterial expression of human domain with His-tag and GST tagDepositorInsertTNKS_TANK-peptide-bind (TNKS Synthetic, Human)
TagsHis-GSTExpressionBacterialPromoterT7/LacOAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_MAD2L1_HORMA
Plasmid#178480PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
CKAP2-mNeonGreen pHAT
Plasmid#175947PurposeBacterial expression of mmCKAP2-mNeonGreen, N-terminal 6xHis-tag, C-terminal Strep-tagIIDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_ZYMND11_coiled-coil MYND
Plasmid#178493PurposeBacterial expression of human domain with His-tag and GST tagDepositorInsertZYMND11_coiled-coil MYND (ZMYND11 Synthetic, Human)
TagsHis-GSTExpressionBacterialPromoterT7/LacOAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_IRF3_SMAD/FHA
Plasmid#178479PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL1-E2C
Plasmid#180421PurposeKan resistant plasmid derived from pBTK402, a broad-host-range plasmid previously shown to replicate in multiple species of bee gut bacteria. It encodes an E2 Crimson promoter.DepositorInsertE2 Crimson
ExpressionBacterialAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MBP-CBX1-eReader
Plasmid#135089PurposeBacterial expression of engineered CBX1 with enhanced binding to H3K9meDepositorInsertCBX1 chromobox protein 1, engineered
Tags6xhis-tag and MBPExpressionBacterialMutationlysine 43 mutated to alanine; aspartic acid 59 mu…PromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-xCas9-sgRNA
Plasmid#179579PurposeExpresses xCas9 and gRNA that targets ColE1 plasmids for curing.DepositorInsertxCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV489
Plasmid#177697PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ) and TDH3p (Candida…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIT5_TL
Plasmid#173768PurposeBacterial genomic integration vectorDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only