We narrowed to 2,336 results for: control GFP
-
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5_EGFP-control
Plasmid#238257PurposeFor overexpression of EGFP-controlDepositorInsertEGFP
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shControl-EGFP
Plasmid#227685PurposeExpresses EGFP and scramble of shRNA targeting Atg7DepositorInsertscrambled shRNA control
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRAR074-control-sfGFP
Plasmid#185032PurposeJ23108 promoter, scrambled 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides of rpmE 5'UTR scrambled, Only fi…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-siRNA control
Plasmid#10900DepositorInsertsiGFP
ExpressionMammalianAvailable SinceFeb. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUPD2-GFP control (B3-B5)
Plasmid#211848PurposeGFP CDS in domestication vectorDepositorInsertGFP
UseSynthetic BiologyAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP (no signal control)
Plasmid#170167PurposeMammalian Expression of no signal controlDepositorTypeEmpty backboneExpressionMammalianMutationn/aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS001.2-GFP (control sensor)
Plasmid#27405DepositorTypeEmpty backboneTagsGFPAvailable SinceFeb. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
Control-TP53-LRG-GFP
Plasmid#225874PurposeGuides targeting P53 and a control sequenceDepositorInsertControl and TP53 (TP53 Human)
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Control-RB1-LRG-GFP
Plasmid#225875PurposeGuides targeting RB1 and a control sequenceDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-IMP2-2_antisense-control
Plasmid#42174DepositorInsertInsulin-like growth factor 2 mRNA binding protein 2-2 antisense control (IGF2BP2 Human)
TagsGFPExpressionMammalianPromoterT7Available SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ control UTRs
Plasmid#67929PurposeTranslational reporter - control UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralExpressionMammalianAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
HyperADAR control
Plasmid#166969PurposeExpress the Hyperactive catalytic domain of Drosophila ADAR and linker at the 5' end of this domain, in the MSCV-IRES-GFPDepositorInsertlinker-hyperADAR
UseRetroviralTagslinker-HyperADARExpressionMammalianPromoterMSCVAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
control (pGS701)
Plasmid#160037PurposepLV-A4-UCOE-EF1-3xHA-GFP-MCS-IRES-BLAS-2A-SNAP-WPRE-A2DepositorTypeEmpty backboneUseLentiviralPromoterEF1Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
GPR_control
Plasmid#216222PurposeGFP P2A RFP control reporterDepositorInsertGFP P2A RFP_stop
ExpressionMammalianAvailable SinceApril 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR_control_lenti
Plasmid#216223PurposeGFP P2A RFP control reporter in a lenti backboneDepositorInsertGFP P2A RFP_stop
ExpressionMammalianAvailable SinceApril 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-AAV-sh[control]
Plasmid#75438Purposecontrol shRNA vectorDepositorInsertGFP
UseAAV and RNAiExpressionMammalianPromoterU6Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOD2045-intControl
Plasmid#100005PurposeMosSCI targeting vector expressing an ubiquitin ligase adaptor ZIF-1, serving as a control for pOD2044-intDEG. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertsUseTargeting vector for mos1 transposon mediated sin…Available SinceSept. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOD2047-bwmControl
Plasmid#100006PurposeMosSCI targeting vector expressing an ubiquitin ligase adaptor ZIF-1, serving as a control for pOD2046-bwmDEG. Expression is controlled by Pmyo-3 (body wall muscle specific).DepositorInsertsUseTargeting vector for mos1 transposon mediated sin…Available SinceSept. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOD2049-csnControl
Plasmid#100007PurposeMosSCI targeting vector expressing an ubiquitin ligase adaptor ZIF-1, serving as a control for pOD2048-csnDEG. Expression is controlled by Posm-6 (ciliated sensory neuron specific).DepositorInsertsUseTargeting vector for mos1 transposon mediated sin…Available SinceSept. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-control-APEX
Plasmid#73187PurposeExpresses "control"-APEX (cytosolic) in mammalian cellsDepositorInsertcontrol-APEX (Nphp3 Mouse, Glycine max)
Tagsinternal GFP tagExpressionMammalianMutationchanged glycine 2 to alaninePromoterEF1alphaAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Control-1
Plasmid#204442PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 mutant protein.DepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control-2
Plasmid#204443PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 mutant protein.DepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control-3
Plasmid#204444PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 mutant protein.DepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control-4
Plasmid#204445PurposeMammalian expression plasmid of GFP-tagged hOpa1 isoform 1 mutant protein.DepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHLuc Control
Plasmid#141091PurposepH-stable bioluminescent reporter that serves as the control counterpart of pHLuc; utilizes eGFP instead of SEPDepositorInsertAntares-T2A-puromycin-IRESv24-eGFP-Nanoluc
ExpressionMammalianPromoterCMVAvailable SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-control
Plasmid#213788PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G-Creon shRNA[Control]
Plasmid#181824PurposeThis vector simultaneously expresses GFP protein and shRNA in a Cre-dependent manner.DepositorTypeEmpty backboneUseAAV and RNAiExpressionMammalianPromoterEF1a/U6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
HoxD del control ds
Plasmid#131336PurposegRNA to delete control region near HoxD. Use with HoxD del control usDepositorInsertCTRL-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HoxD del control us
Plasmid#131335PurposegRNA to delete control region near HoxD. Use with HoxD del control dsDepositorInsertCTRL-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Endosomal Escape Control
Plasmid#186552PurposeNegative Control confirming the need for a CPP peptide in mediating internalizationDepositorInsert6H-ETA-GFP
Tags6xHis and EGFPExpressionBacterialPromoterT7Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV miRNA control plasmid
Plasmid#31508DepositorTypeEmpty backboneUseRetroviralTagsGFPExpressionMammalianAvailable SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-control
Plasmid#216857PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing transcript at the synapse. CIRTS-YTHDF2-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_UGControl
Plasmid#133875PurposeExpresses UGControl in mammalian cellsDepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Control V5-Twist
Plasmid#201376PurposeExpresses Twist for nucleocytoplasmic transport studiesDepositorAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1P_EGFP
Plasmid#232171PurposeEGFP expression under the control of the human Synapsin-1 promoterDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2_-87prox1a:basEGFP_Acry:GFP
Plasmid#218213PurposeZebrafish -87prox1a enhancer reporter in the lymphatics at 5 dpf. Acry_GFP as a control in the lensDepositorInsert-87prox1a
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Internalization Control
Plasmid#186553PurposeNegative Control mediating endosomal localizationDepositorInsert10R-8His-EGFP
Tags8xHisExpressionBacterialPromoterT7Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-R-Creon shRNA[Control]
Plasmid#180775PurposeThis vector simultaneously expresses mCherry protein and shRNA in a Cre-dependent manner.DepositorTypeEmpty backboneUseAAV, Cre/Lox, and RNAiExpressionMammalianAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI control for Target-AID (pRZ1047)
Plasmid#131299PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP (Target-AID without pmCDA1).DepositorInsertNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
groSL-GFP
Plasmid#109389PurposeGFP cassette under the control of the groSL sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertpgroSL-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
ibpAB-GFP
Plasmid#109390PurposeGFP cassette under the control of the ibpAB sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertpibpAB-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
htpG1-GFP
Plasmid#109387PurposeGFP cassette under the control of the htpG1 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG1-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
htpG2-GFP
Plasmid#109388PurposeGFP cassette under the control of the htpG2 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG2-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
iChr2-Control-Mosaic (SO274)
Plasmid#99751PurposeSecond generation Rosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different chromatin localized fluorescent proteinsDepositorInsertHIs-H2B-Cherry, H2B-EGFP, HA-H2B-Cerulean
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG CMV EGFP Puro
Plasmid#237884PurposeMammalian EGFP expression plasmid, control plasmid for Addgene #237881DepositorInsertEGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits