We narrowed to 8,684 results for: PAN
-
Plasmid#145279PurposeBacterial Expression of 6xHis mCherry Fusion ProteinDepositorInsertmCherry
ExpressionBacterialAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCKmatBC
Plasmid#138587PurposematBC cassette from R. trifolii controlled by a Plac promoter; pSC101 ori, catDepositorInsertbicistronic cassette containing a malonate transporter (matC) and a malonyl-CoA synthetase (matB)
UseSynthetic BiologyExpressionBacterialMutationmatB contains native GUG start codonPromoterPlac promoterAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT277
Plasmid#122608Purposeexpress evoCDA1-BE4max in mammalian cellsDepositorInsertevoCDA1-BE4max
ExpressionMammalianMutationF23S A123V I195FAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-NHX1-HaloTagx2
Plasmid#177107PurposeExpresses Nhx1-HaloTagx2 in yeast cellsDepositorInsertNHX1 (NHX1 Budding Yeast)
ExpressionYeastAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-NHX1-iGFP
Plasmid#177108PurposeExpresses Nhx1-iGFP in yeast cellsDepositorInsertNHX1 (NHX1 Budding Yeast)
ExpressionYeastAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.27_GRHL-SPE
Plasmid#177774PurposeLuciferase reporter for GRHLDepositorInsertGRHL
UseLuciferaseAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRCA360 - pBA904 Puro-T2A-GFP
Plasmid#238164PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseLentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBES1-LacOx50-Hyg
Plasmid#210261PurposeIntegrates 50xLacO repeats upstream of the BES1 promoter with a hygromycin drug selection marker downstream of the promoter.DepositorInsert50xLacO repeats derived from: PMID: 12864855.
Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
ABE8r-R153del
Plasmid#208296PurposeExpresses ABE8r in mammalian cellsDepositorInsertTadA8r-R153del-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76Y, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFP.E227
Plasmid#138249PurposeReporter plasmid - Expresses three fluorescent reporters from three different ECF promotersDepositorInsertsmCherry
Terminator
mTagBFP
Terminator
gfp
Terminator
UseSynthetic BiologyTags6xHisExpressionBacterialPromoterP17_up1691, P20_992, and iP16_3622Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT29-splitD
Plasmid#122599Purposeclone M13 phage by SapI Golden GateDepositorInsertM13 bacteriophage genes
ExpressionBacterialAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT29-splitC
Plasmid#122598Purposeclone M13 phage by SapI Golden GateDepositorInsertM13 bacteriophage genes
ExpressionBacterialAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD268
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD282
Plasmid#66823PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertGFP-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized GFPExpressionWormAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT372
Plasmid#125613PurposeExpresses evoCDA1-BE4max-NG in mammalian cellsDepositorInsertevoCDA1-BE4max-NG
ExpressionMammalianMutationF23S A123V I195FAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGFP FRNK
Plasmid#50518PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorInsertprotein tyrosine kinase, mutated
TagsGFPExpressionMammalianMutationtruncated (NT2186-3268)PromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNZ18-CAH
Plasmid#203159PurposeReplicates in E. coli, S. cerevisiae, and A. laidlawiiDepositorInsertYeast centromere, autonomously replicating sequence, histidine auxotrophic marker
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT120b
Plasmid#122604PurposeBE PACE selection, express gIII, luxAB and degron-GTCCA guide RNADepositorInsertgIII, luxAB, guide RNA
UseSynthetic BiologyAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgControl
Plasmid#230080PurposeCrispr knock out controlDepositorInsertnon-specific sequence control
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBES1-LacOx50-mCh-bla
Plasmid#210260PurposeIntegrates 50xLacO repeats and an mCherry gene upstream of the BES1 promoter with a hygromycin drug selection marker downstream of the promoter.DepositorInserts50xLacO repeats derived from: PMID: 12864855.
mCherry
Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSB1K3_M13ps_LacZα_gIII
Plasmid#190435PurposeM13 packaging signal, LacZα gene, and M13 gIII gene (also called gp3, or g3p) cloned into the pSB1K3 vector.DepositorInsertsM13 packaging signal
M13 gIII
LacZα
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-FLuc
Plasmid#188311PurposeExpression of Firefly luciferase via a T7 promoter in TXTLDepositorInsertFirefly luciferase
UseLuciferase and Synthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-RLuc
Plasmid#188312PurposeExpression of Renilla luciferase via a T7 promoter in TXTLDepositorInsertRenilla luciferase
UseLuciferase and Synthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE8r
Plasmid#208294PurposeExpresses ABE8r in mammalian cellsDepositorInsertTadA8r-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76Y, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean
Plasmid#24334DepositorInsertH2B
UseCre/LoxTagsGFPExpressionWormMutationmCherry driven by an HSP70 promoterCerulean drive…Available SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-DDX4N-mCh-Cry2WT
Plasmid#101225PurposeDDX4(1-236) fused to mCh-Cry2WTDepositorInsertDDX4(1-236)
UseLentiviralExpressionMammalianPromoterSFFVAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAL1
Plasmid#197285PurposeShuttle plasmid that replicates in E. coli, S. cerevisiae, and A. laidlawii. Contains the OriC from A. laidlawii 8195DepositorInsertOrigin of replication of A. laidlawii 8195: whole dnaA gene, plus upstream and downstream intergenic regions
UseSynthetic Biology; Bacterial and yeast cloningAvailable SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only