We narrowed to 165,567 results for: addgene
-
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH47742:FCP:Cas9YFP
Plasmid#85986PurposeGolden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoterDepositorInsertCas9
UseCRISPR; Golden gate assemblyTagsSV40 NLS, YFPPromoterFCPAvailable SinceJan. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICH47732:FCP:NAT
Plasmid#85984PurposeGolden Gate Level 1 cassette encoding a Nat selectable marker under the FCP promoterDepositorInsertNAT
UseGolden gate assemblyPromoterFCPAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV/hSyn-SCLM
Plasmid#216760PurposeAAV2 transfer vector with the human synapsin I promoter for neuronal expression of SuperClomeleonDepositorInsertSuperClomeleon
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterhSyn (human synapsin I)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ERoxBFP
Plasmid#68126Purposemammalian expression of ER localized oxBFPDepositorInsertoxBFP
TagsKDEL ER retention sequence and bovine prolactin s…ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
ER-moxMaple3
Plasmid#120885Purposemammalian expression of ER localized moxMaple3DepositorInsertmoxMaple3
TagsKDEL ER retention sequence and bovine prolactin s…ExpressionMammalianPromoterCMVAvailable SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::ZeoR-bGHpA
Plasmid#62441PurposeMXS_chaining vector with CMV::ZeoR-bGHpADepositorInsertresistance cassette against Zeocin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
TALEN-mROSA26 ELD
Plasmid#60026PurposeExpression of a TALEN protein specific for mouse ROSA26 locus.DepositorInsertTALEN-ROSA26
UseTALENExpressionMammalianAvailable SinceNov. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2(newHA1)
Plasmid#104873PurposeHACK Donor plasmids for converting GAL4 lines to QF2 lines using HACK method. Updated version of Addgene#80275 for easier cloning of insertsDepositorInsertT2A-QF2
UseCRISPRExpressionInsectAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-mRFP1-Human UTROPHIN_1-261
Plasmid#225052PurposeExpress in mammalian cells the mRFP1 fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and RFP1 (UTRN Human, Homo Sapiens)
UseLentiviralTagsHuman UTROPHIN 1-261 and mRFP1ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26739-R…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Human, Homo Sapiens)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-CXCR4 (neo)
Plasmid#192077PurposeLentivirus for expression of CXCR4DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF-I-GFP GX
Plasmid#45443DepositorTypeEmpty backboneTagsIRES EGFPExpressionMammalianPromoterhuman EF1αAvailable SinceJuly 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
p8267 LentiCRISPR v2 hygro sgNT-2
Plasmid#193978PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only