We narrowed to 32,890 results for: cmv
-
Plasmid#58918Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S807 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S807 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
p7128 pHAGE-P-CMVt-N-HA-GAW-HLA-A
Plasmid#100154PurposeExpresses HLA-ADepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S788
Plasmid#58916Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S788 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S788 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T356
Plasmid#58911Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T356 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T356 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T821
Plasmid#58920Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T821 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T821 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
KI(GAPDH)-P2A-EGFP-CMV-NeoR
Plasmid#114009PurposeHDR-cassette to target chicken GAPDH gene for EGFP expression under control of the endogenous promoter. The cassette contains NeoR gene for positive clone selection and DTA gene for negative selectionDepositorInsertsExpressionMammalianPromoter-, CMV, and endogenous promoter (chicken GAPDH in…Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-Flag-mIL-17RA/YFP.Hygro
Plasmid#46862Purposeencodes Flag-tagged mouse IL-17RA fused to Yellow Fl. ProteinDepositorInsertIL-17RA-YFP
TagsFlag/IL-3 signal sequence and fused to CFPExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaCC-HA.SV40(polyA)
Plasmid#155195PurposeExpresses murine Thrombospondin-1 (THBS1) protein with deletion of Coiled Coil domain and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 276-315PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEmax(TadA, TadA*E59A)
Plasmid#125662PurposepCMV-ABEmax(TadA, TadA*E59A) in mammalian cellsDepositorInsertABEmax(TadA E59A TadA* E59A)
ExpressionMammalianAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSSM97: pCMV-HA-NLS-SpuFz1-E498R
Plasmid#205275PurposeHuman expression vector for human codon optimized N-terminal NLS-tagged SpuFz1-E498RDepositorInsertSpuFz1
TagsHA, NLS(Makkerh)ExpressionMammalianMutationE498RAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSSM105: pCMV-HA-NLS-SpuFz1-T513K
Plasmid#205276PurposeHuman expression vector for human codon optimized N-terminal NLS-tagged SpuFz1-T513KDepositorInsertSpuFz1
TagsHA, NLS(Makkerh)ExpressionMammalianMutationT513KAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSSM58: pCMV-HA-NLS-SpuFz1-D487K
Plasmid#205274PurposeHuman expression vector for human codon optimized N-terminal NLS-tagged SpuFz1-D487KDepositorInsertSpuFz1
TagsHA, NLS(Makkerh)ExpressionMammalianMutationD487KAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSSM59: pCMV-HA-NLS-SpuFz1-D300R
Plasmid#205272PurposeHuman expression vector for human codon optimized N-terminal NLS-tagged SpuFz1-D300RDepositorInsertSpuFz1
TagsHA, NLS(Makkerh)ExpressionMammalianMutationD300RAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-Y705F-STAT3-3xFlag
Plasmid#99261PurposeAdenoviral vector encoding Flag-tagged murine STAT3 (Y705F)DepositorInsertSignal transducer and activator of transcription 3 - Y705F (Stat3 Mouse)
UseAdenoviralTags3x-FlagMutationY705F (contains a silent mutation: nucleotide 271…PromoterCMVAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.R404X) 3x FLAG
Plasmid#74263PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.R404X truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120
Plasmid#123116PurposeExpresses EGFP-LC3B G120 in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFPExpressionMammalianMutationDeleted amino acids 121-125. Stop codon after G12…PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T826
Plasmid#58921Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T826 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T826 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-4SA(S164)
Plasmid#33083DepositorInsertYAP (YAP1 Human)
TagsFlagExpressionMammalianMutationS61A, S109A, S127A, S381APromoterCMVAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTS1026-Tier1-PhCMV-3xNLS-iRFP670
Plasmid#169532PurposeTier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).DepositorInsertPCMV-driven nucleus-localized far-red fluorescent protein iRFP670
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3.1-NLS(sv40) (RTW2624)
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/WT SPAST without 5'UTR
Plasmid#87732PurposeExpresses WT spastin M1 and M87 in mammalian cellsDepositorAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Flag-RIOK3-STOP_IDG-K
Plasmid#170576PurposeGateway destination clone of RIOK3 (human) tagged with N-terminal Flag for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertFlag-RIOK3 (RIOK3 Human)
UseLentiviral; Gateway destinationTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S249
Plasmid#58908Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S249 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S249 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(R346C)
Plasmid#164206PurposeExpresses CRY2oligo-mcherry tagged ANXA11 R346C mutant under CMV promoterDepositorInsertANXA11 (ANXA11 Human)
TagsCRY2oligo-mcherryExpressionMammalianMutationR346CPromoterCMVAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
HOXA9 (murine) FLAG pRC/CMV
Plasmid#8514DepositorInsertHOXA9 (Hoxa9 Mouse)
TagsFLAG and HisExpressionMammalianMutationFLAG epitope tag replaces T7 tag in the pET back…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-RNF8-N-terminus(1-140)
Plasmid#64675Purposeexpresses only N terminus of RNF8, amino acids 1 to 140DepositorInsertRing finger protein 8 (RNF8 Human)
TagsFLAGExpressionMammalianMutationonly N terminus amino acids 1-140PromoterCMVAvailable SinceMay 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-UBE3BΔHECT-copGFP-Puro
Plasmid#107343PurposeExpresses UBE3B deletion of HECT domain fused to copGFP in mammalian cells.DepositorInsertUBE3B(ΔHECT)-copGFP (UBE3B Human)
UseLentiviralTagscopGFPExpressionMammalianMutationdeletion of HECT domain (757-end)PromoterCMVAvailable SinceJune 26, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-P2A-mScarlet (MNW006)
Plasmid#174136PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorInserthuman codon optimized SpG with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag p38 alpha(agf)
Plasmid#20787DepositorInsertpCMV5 Flag p38 alpha (agf) (Mapk14 Mouse)
TagsFlagExpressionMammalianMutationreplaced Thr180 and Tyr182 with Ala and Phe, resp…Available SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK21054-5FF-VSV
Plasmid#139347PurposeExpression of TYK2 protein mutated in the two tyrosines (Y1054F/Y1055F) of the activation loopDepositorInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
ExpressionMammalianMutationV362F-Y1054F-Y1055FPromoterCMVAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Construct 7 - CMVp-Cas9-3xNLS-HSVpA
Plasmid#81247PurposeExpresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expressionDepositorInsertCas9-3xNLS
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
p7055 pHAGE-P-CMVt-N-HA-GAW-COPZ1
Plasmid#100145PurposeExpresses COPZ1DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV TIP60 212-364
Plasmid#78795PurposeTo overexpress TIP60 212-364 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-