We narrowed to 7,680 results for: CCH
-
Plasmid#193314PurposeDoxycycline-induced transcriptional regulation and Ubiquitin - LEU - 4xMYC N-terminal tagging. Ubiquitin is cleaved off, resulting in an unstable protein with an N-terminal leucine.DepositorInsertUbiquitin - Leucine - 4MYC N-terminal tagging
Tags4MYCExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
HYG-TET-OFF – ubiquitin – LEU – 4MYC
Plasmid#193316PurposeDoxycycline-induced transcriptional regulation and Ubiquitin - LEU - 4xMYC N-terminal tagging. Ubiquitin is cleaved off, resulting in an unstable protein with an N-terminal leucine.DepositorInsertUbiquitin - Leucine - 4MYC N-terminal tagging
Tags4MYCExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2Katushka-ter-Hygromycin
Plasmid#184772PurposeRed marker for yeast late Golgi/early endosome. Integration of 2xKatushka tag at SEC7 C terminus. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
PKC1-2GFP-ter-TRP1
Plasmid#184773PurposeIntegration of 2xGFP tag at PKC1 C terminus. Uses auxotrophic marker TRP1(Kluyveromyces lactis).DepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_mcherry
Plasmid#167894PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_mcherry
Plasmid#167870PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D42
Plasmid#185840PurposeTesting the TEF1 promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[Z268]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2E
Plasmid#185866PurposeKnocking out ALD6DepositorInsertALD(-125, 40)- ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF71
Plasmid#185860PurposeTesting the SkGAL2 promoter inserted with 4 Z268 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2+[Z268]>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B9)
Plasmid#185858PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M5(5*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72
Plasmid#185857PurposeTesting the SkGAL2 promoter inserted with 4 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M4(4*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1B
Plasmid#185856PurposeTesting the SkGAL2 promoter inserted with 3 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M2(3*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1A
Plasmid#185855PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M1(2*PZ4)> (BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (1)
Plasmid#185851PurposeTesting the TEF1 promoter appended with 2 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>2*TcRb>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9358(VII-1_Markerfree_BackBone)
Plasmid#161599PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VII-1, (Chr VII: 438509..438490)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9359(VIII-1_Markerfree_BackBone)
Plasmid#161600PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VIII-1, (Chr VIII: 293615..293634)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9361(XIII-1_Markerfree_BackBone)
Plasmid#161602PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XIII-1, (Chr XIII: 306804..306823)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9363(XVI-1_Markerfree_BackBone)
Plasmid#161604PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XVI-1, (Chr XVI: 406267..406286)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB439
Plasmid#185093PurposeNMA111-GFP wild type under control of GAL1 promoter (complements nma111 deletion)DepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::NMA111-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB462
Plasmid#185095PurposeNMA111-GFP with NLS1 and NLS2 mutated under control of GAL1 promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::nma111Dnls1Dnls2-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB394
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
TagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB106
Plasmid#185065PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion including C-terminal half of Nup1 C-terminal FG domainDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated so C-terminal h…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2373-Tier1-PhCMV-Gal4
Plasmid#169581PurposeTier-1 vector encoding PhCMV-driven Gal4 DNA binding domain (PhCMV-Gal4-pA).DepositorInsertregulatory protein GAL4
ExpressionMammalianPromoterPhCMVAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
CcCDP_p15A
Plasmid#179272PurposeExpresses CcCDP in E. coli BL21(DE3)DepositorInsertcellodextrin phosphorylase
UseSynthetic BiologyTags6xHISExpressionBacterialPromoterT7 lacOAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-Scp20_18-49-GB1_AF
Plasmid#148720PurposeBacterial Expression of Scp20_18-49DepositorInsertScp20_18-49 (CAF20 Budding Yeast)
ExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-ScEap1p_91-150_AF
Plasmid#148710PurposeBacterial Expression of ScEap1p_91-150DepositorInsertScEap1p_91-150 (EAP1 Budding Yeast)
ExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_10bp 5'SS_No BP or pBP_pUC18
Plasmid#100989PurposeRp51a with a tGGTAtGTta->AGGTAAGTAT 5'SS mutant with potential to form 10bps with the U1 snRNA. Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationtGGTAtGTta->AGGTAAGTAT 5'SS mutant, TACTA…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_SUS1 5'ss_No_BP_pBP-pUC18
Plasmid#100990PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence). Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutant, TACTAAC->…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Hygro_zhang2.0
Plasmid#167915PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA EYFP_zhang2.0
Plasmid#167914PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_KanR neo
Plasmid#167893PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_iRFP713
Plasmid#167892PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_Hygro
Plasmid#167891PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_EBFP2
Plasmid#167889PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_Blasto
Plasmid#167888PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_iRFP713
Plasmid#167868PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_Hygro
Plasmid#167867PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_EBFP2
Plasmid#167865PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_iRFP713
Plasmid#167860PurposePiggyBac compatible plasmid expressing spCas9DepositorInsertCas9
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-XI1up
Plasmid#176166Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site XI-1DepositorInsert5' homology for integration site XI-1
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC7-XI1dw
Plasmid#176167Purposeyeast MoClo level-0 part plasmid type 7 containing 3' homology for integration site XI-1DepositorInsert3' homology for integration site XI-1
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-XI2up
Plasmid#176168Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site XI-2DepositorInsert5' homology for integration site XI-2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC7-XI2dw
Plasmid#176169Purposeyeast MoClo level-0 part plasmid type 7 containing 3' homology for integration site XI-2DepositorInsert3' homology for integration site XI-2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-XII2up
Plasmid#176174Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site XII-2DepositorInsert5' homology for integration site XII-2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC7-XII2dw
Plasmid#176175Purposeyeast MoClo level-0 part plasmid type 7 containing 3' homology for integration site XII-2DepositorInsert3' homology for integration site XII-2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-X4up
Plasmid#176164Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site X-4DepositorInsert5' homology for integration site X-4
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC7-X4dw
Plasmid#176165Purposeyeast MoClo level-0 part plasmid type 7 containing 3' homology for integration site X-4DepositorInsert3' homology for integration site X-4
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS42K_MCP-VP64_D-MS2
Plasmid#177161PurposeExpresses transactivator (MCP-VP64) and scRNA (D-MS2) in yeast cellsDepositorInsertsMCP-VP64
D-MS2
TagsSV40 NLSExpressionYeastPromoterADH1 promoter and SNR52 promoterAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS42K_PCP-VP64_A-PP7
Plasmid#177156PurposeExpresses transactivator (PCP-VP64) and scRNA (A-PP7) in yeast cellsDepositorInsertsPCP-VP64
A-PP7
TagsSV40 NLSExpressionYeastPromoterADH1 promoter and SNR52 promoterAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only