We narrowed to 3,327 results for: pEGFP
-
Plasmid#67628PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, and dOraiDepositorInsertdmBACCS2NS-IRES-dOrai
ExpressionMammalianPromoterCMVAvailable sinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
C1-FT-mCitrine-EAAARx8-CaaX
Plasmid#155224PurposeMPAct with increased search radiusDepositorInsertF-tractin (aa9-52 of rat ITPKA) fused to mCitrine C-term tagged with codon optimized (EAAAR)x8 and CaaX seq derived from Kras4b
TagsmCitrineExpressionMammalianAvailable sinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-PKI nls
Plasmid#118301PurposeExpression of PKIaDepositorInsertPKI nls (aa 2-36)
TagsFlag and GFPExpressionMammalianMutationinserting 2xnlsAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pH4R-P2A-mCherry-N1
Plasmid#84333PurposeCo-expresses (untagged) Histamine-4 receptor and mCherryDepositorAvailable sinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
5HT2C-RNA1-FLAG
Plasmid#79678Purposeserotonin receptor 2C RNA isoform 1 with C-terminal flag tagDepositorAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNMHCII-C1C2-GFP
Plasmid#46044DepositorInsertnonmuscle myosin heavy chain II-C, isoform C1C2 (Myh14 Mouse)
TagsGFPExpressionMammalianPromoterCMV immediate earlyAvailable sinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
ATF4 13: 5’ATF4.uORF2AUA.GFP
Plasmid#21860DepositorPublicationInsertATF4 (Atf4 Mouse)
TagsEGFPExpressionMammalianMutationAUG codon of uORF2 was converted to AUAAvailable sinceSept. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 GBP (GBP-mEos2)
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
TagsmEos2ExpressionMammalianAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora_CA
Plasmid#98170Purposeslow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora_C128A gene
TagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, C128A, P24…PromoterCMV (+enhancer)Available sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hPMLIII
Plasmid#103808PurposeBLInCR 'Localizer' construct that marks the PML nuclear bodies and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
NES-EGFP-PH-BTKx2
Plasmid#183652PurposePtdIns(3,4,5)P3 biosensorDepositorInsertBTK (BTK Frog, Human)
TagsX. laevis map2k1.L(32-44)-EGFPExpressionMammalianMutationAmino acids 2-174 and 2-170PromoterCMVAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Diffusive 67kDa
Plasmid#201338PurposeNucleocytoplasmic transport probeDepositorInsertEGFP-6PrA
ExpressionMammalianAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMVd1-NLS-GAL4-iLight2-VP16-T2A-mTagBFP2
Plasmid#219548PurposeNLS-Gal4(1-65)-iLight2-VP16-T2A-mTagBFP2 construct expression in mammalian cells.DepositorInsertNLS-Gal4(1-65)-iLight2-VP16-T2A-mTagBFP2
ExpressionMammalianMutationThe (SAGG)x4 linker between GAL4(1-65) and the PC…PromoterCMVd1Available sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
mScarlet-I-T2A-LSS-SGFP2
Plasmid#112946PurposeProduces equimolar levels of two fluorescent proteins. It can be used to measure practical brightness and as a negative control for FRETDepositorInsertmScarlet-I and LSS-SGFP2
ExpressionMammalianPromoterCMVAvailable sinceSept. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TfRΔEctoR1-eGFP A206K
Plasmid#113554PurposeTransmembrane model receptor to probe receptor internalization via clathrin mediated pathwayDepositorInsertTfRΔEctoR1-eGFP A206K
ExpressionMammalianMutationeGFP A206KAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMulti-sgRNA-LacZ
Plasmid#99913PurposeReceptor plasmid for the assembly of multiple sgRNAsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xmts-G-Ca-FLITS
Plasmid#191462PurposeGenetically encoded calcium sensor (GECI) G-Ca-FLITS that reports with a lifetime changeDepositorInsertG-Ca-FLITS
Tags4xmtsExpressionMammalianAvailable sinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCIBN-LacI-tagRFP-T
Plasmid#103810Purpose'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPA32-EGFP
Plasmid#211383Purposemammalian expression of human RPA32 C-terminally fused to EGFPDepositorAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only