We narrowed to 43,917 results for: gats
-
Plasmid#186351PurposeGateway donor vector with AttP3 AttP4 recombination sitesDepositorTypeEmpty backboneUseGateway donor vectorAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pGGY003
Plasmid#48867PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA left border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGZ003
Plasmid#48869PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA left border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGZ001
Plasmid#48868PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA right border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-nLuc
Plasmid#199755PurposeControl construct of elongation reporter to quantify elongation of YFPDepositorInsertNanoluc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGF007
Plasmid#48847PurposeProvides a kanamycin resistance cassette as GreenGate module.DepositorInsertpNOS::KanamycinR::tNOS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGF005
Plasmid#48846PurposeProvides a hygromycin resistance cassette as GreenGate module.DepositorInsertpUBQ10::HygromycinR::tOCS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pME-TagBFP-NS
Plasmid#75342PurposeMultisite gateway entry clone for adding N-terminal fusions of TagBFPDepositorInsertTagBFP
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-NS
Plasmid#75341PurposeMultisite gateway entry clone for adding N-terminal fusions of EGFPDepositorInsertEGFP
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGY001
Plasmid#48866PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA right border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGA004
Plasmid#48815PurposeProvides the 35S promoter as GreenGate module.DepositorInsert35S promoter
UseGolden gate compatible cloning vectorMutationinternal BsaI recognition site removed by substit…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGF003
Plasmid#48844PurposeProvides a D-alanine resistance cassette as GreenGate module.DepositorInsertpMAS::D-AlanineR::tMAS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pME-TagRFPt-NS
Plasmid#75343PurposeMultisite gateway entry clone for adding N-terminal fusions of TagRFPtDepositorInsertTagRFPt
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-221-P3-P5
Plasmid#186350PurposeGateway donor vector with AttP3 AttP5 recombination sitesDepositorTypeEmpty backboneUseGateway donor vectorAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAM3558
Plasmid#40252DepositorInsertGm cassette (BssHII+SphI)
UseCyanobacteria cloning vectorPromotern/aAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGF001
Plasmid#48842PurposeProvides a BASTA resistance cassette as GreenGate module.DepositorInsertpMAS::BastaR::tMAS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pANG02
Plasmid#178084PurposeGentamycin resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG01 or pANG03.DepositorTypeEmpty backboneExpressionBacterialPromoterNAAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LI C-D Dest
Plasmid#104518PurposeLI Gateway cassetteDepositorInsertGateway cassette
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT029h
Plasmid#96861Purpose(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)DepositorInsert(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only