We narrowed to 2,453 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-STIM1(238-685)
Plasmid#248297PurposeAn expression construct encoding an EGFP-fused STIM1 fragment (a.a.238-685).DepositorInsertEGFP-fused STIM1 fragment (a.a.238-685) (STIM1 )
TagsEGFPExpressionMammalianMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVM-SFT-SP
Plasmid#234902PurposeThis all-in-one vector is used to overexpress the GhSFT gene via virus-mediated overexpression (VOX), and specifically silence the GhSP gene via virus-induced gene silencing (VIGS), simultaneously.DepositorInsertAdditional VA component flanked with VIGS fragment of GhSP gene and coding sequence of GhSFT
ExpressionPlantAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43 (4SA)
Plasmid#235499PurposeExpression of human TDP-43-EGFP with phospho-dead mutations in the C-terminusDepositorAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-TDP-43 (2KR)
Plasmid#235494PurposeExpression of human TDP-43-EGFP with K136R and K408R mutationsDepositorAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-TDP-43 (K408R)
Plasmid#235493PurposeExpression of human TDP-43-EGFP with K408R mutation to block SUMOylationDepositorAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1a
Plasmid#176020PurposeLeishmania cell free expression of zebrafish EGFP-Bin1a. Parton lab clone GRQDepositorInsertBin1a
UseLeishmania cell free expressionTagsEGFPAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-mCherry-Bin1a
Plasmid#176024PurposeLeishmania cell free expression of zebrafish mCherry-Bin1a. Parton lab clone GSSDepositorInsertBin1a
UseLeishmania cell free expressionTagsmCherryAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_KLF4
Plasmid#140104PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-sfGFP-iCre-ERT2-FNF-TK
Plasmid#126651PurposeB6J Lrig1-T2A-sfGFP-iCre-ERT2 allele targeting vector, low copy numberDepositorInsertLrig1 (Lrig1 Mouse)
UseCre/Lox and Mouse TargetingMutationC-terminal fusion of T2A-sfGFP-iCre-ERT2Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pOst1-pro-alphaf(MUT2)-E2-Crimson
Plasmid#117663PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpOst1-pro-af(MUT2)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-C1-TGAT(C242S,C253S)
Plasmid#84336PurposeExpresses TGAT tagged with mCherryDepositorInsertTGAT(C242S,C253S) (TRIO Human)
TagsmCherryExpressionMammalianMutationC242S, C253SPromoterCMVAvailable SinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-SNAP-TERT
Plasmid#71390PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes PURO resistance flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson
Plasmid#117661PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-Ost1-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3- sgAAVS1.5-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216246PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and a highly efficient sgAAVS1.5 for AAVS1 integrationDepositorInsertCas9 and sgAAVS1.5
UseCRISPR; Human safe harbor locus (a avs1) site-spe…ExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only