We narrowed to 2,378 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32D178Y-IRES-GCaMP6s
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2_DD-HNF4A8_C106R
Plasmid#31096DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsFKBP L106P and mycExpressionMammalianMutationsplice variant 8 derived from promoter P2 with zi…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX311-GFP-MEKDD
Plasmid#194882PurposeExpression of dominant negative MEK1DepositorAvailable SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216251PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgSEC61B.N1 to tag endogenous SEC61B N-terminusDepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-p110 CUX1
Plasmid#100816PurposeGateway lentiviral vector expressing p100 CUX1 (amino acids 747-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertHs CUX1 amino acids 747-1505 of P39880 (CUX1 Human)
UseLentiviralTagsHA and mycExpressionMammalianMutationcontains amino acids 747-1505Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-EGFP-CRY2-STIM1(318-450)
Plasmid#248300PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterCamKllaAvailable SinceFeb. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-FLAG-STIM1(238-685)
Plasmid#248299PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterCamKllaAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-EGFP-CRY2-STIM1(318-450)
Plasmid#248302PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only