We narrowed to 2,378 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pAAV-GfaABC1D-FLAG-STIM1(238-685)
Plasmid#248301PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN WT
Plasmid#247940PurposeAAV transfer plasmid encoding the human α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNB1-LOX
Plasmid#154058PurposeLevel 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosTDepositorInsertLoxP-flanked GUS and TtNAM-B1
UseSynthetic BiologyExpressionBacterialMutationThe TtNAM-B1 gene sequence was domesticated to re…PromoterZmUbiAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-TRAC-CD19.CAR-Cas12a.PAM.mutated
Plasmid#215769Purposeencodes for HDR template for optimized AsCas12a-mediated knock-in of a CD19-specific CAR into the TRAC locusDepositorInsertsExpressionBacterialMutationCas12a PAM mutatedAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hMer
Plasmid#225996PurposeExpresses a chimeric construct having N-terminal human EGFR and C-terminal human MerTKDepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PR.Cre
Plasmid#192933PurposepShuttle.Cre encoding sgRNAs targeting Trp53 and Rb1 genesDepositorAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGGG-Sr43
Plasmid#186974PurposeSr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).DepositorInsertSr43
TagsNoneExpressionBacterial and PlantMutationNonePromoterNaticeAvailable SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PR.CC9
Plasmid#192932PurposepShuttle.CC9 encoding sgRNAs targeting Trp53 and Rb1 genesDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hTyro
Plasmid#225998PurposeExpresses a chimeric construct having N-terminal human EGFR and C-terminal human Tyro3DepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF2-EFGR-hAxl
Plasmid#225997PurposeExpresses a chimeric contruct having N-terminal human EGFR and C-terminal human AxlDepositorExpressionMammalianPromoterEF1-aAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAd-PR.Cre
Plasmid#192936PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1 and CreDepositorAvailable SinceDec. 12, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pShuttle-PRL.Cre
Plasmid#192934PurposepShuttle.Cre encoding sgRNAs targeting Trp53, Rb1 and Rbl2 genesDepositorAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAd-PR.CC9
Plasmid#192935PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1, Cre and Cas9DepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGG_Sr1644-1Sh
Plasmid#164087PurposeExpresses pGGG_Sr1644-1Sh in plantsDepositorInsertpGGG_Sr-1644-1Sh
TagsnoneExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSYC-201
Plasmid#178963PurposeHuman GFAP fused to 3xFLAG tag and EGFP driven by zebrafish gfap promoter for Tol2 mediated recombinationDepositorInsertsUseTol2 mediated recombinationTags3xFLAGPromoterzebrafish gfap promoterAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only