We narrowed to 24,118 results for: CRISPR
-
Plasmid#47944PurposeExpresses C. elegans optimized Cas9::mEGFP from the eef-1A.1 (eft-3) promoterDepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLS, egl-13 NLS, and mEGFPExpressionWormPromotereef-1A.1 (eft-3)Available SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRU292
Plasmid#167687PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL690
Plasmid#47753PurposeExpresses dCas9-VP64 fusionDepositorInsertdCas9-VP64
UseCRISPRTags3x FLAG, NLS, and VP64ExpressionMammalianMutationD10A and H840A mutations in Cas9PromoterCMVAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTX179
Plasmid#89261PurposeExpress STU (Single Transcriptional Unit) Cas9 nickase with Maize Ubiquitin1 promoter in plantsDepositorTypeEmpty backboneUseCRISPRTagsSV40 NLSExpressionPlantAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330A_FokI-1x2
Plasmid#63602PurposeExpresses FokI-dCas9 and gRNADepositorInsertFokI-dCas9
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRU61
Plasmid#167692PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::asCpf1
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–CgRNA
Plasmid#64955PurposeControl gRNA (GTCAAGGCACTCTTGCCTA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-SSFV-dCas9-GFP
Plasmid#64105PurposeExpression of Sp dCas9-GFP in mammalian cellsDepositorInsertSp dCas9
UseCRISPR and LentiviralTagssfGFPExpressionMammalianPromoterSSFVAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_Puro
Plasmid#167871PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMB63
Plasmid#47945PurposeExpresses C. elegans optimized Cas9 from the eef-1A.1 (eft-3) promoterDepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLS, and egl-13 NLSExpressionWormPromotereef-1A.1 (eft-3)Available SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only