We narrowed to 2,587 results for: urod
-
Plasmid#196695PurposeAs mBFP-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationLys to Val substitution at position 612PromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TARDBP-A315T
Plasmid#141324PurposeGateway cloning of TARDBP-A315TDepositorInsertTARDBP-A315T (TARDBP Human)
UseGateway cloningTagsExpressionMutationA315TPromoterAvailable sinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorInserthuman ATP13A2 (ATP13A2 Human)
UseLentiviralTagsExpressionMutationD508N , D962NPromoterCMVAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLEX-PGK-ANXA11-mCerulean
Plasmid#164214PurposepLEX lentivirus backbone expresses mCerulean tagged ANXA11 under PGK promoterDepositorInsertANXA11 (ANXA11 Human)
UseLentiviralTagsmCeruleanExpressionMutationPromoterPGKAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT1
Plasmid#66818PurposedCas9 fused to BFP and the human DNMT1 catalytic domainDepositorInsertdCas9-BFP-DNMT1, catalytic domain (DNMT1 )
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pADC10-SETXhel
Plasmid#193056PurposeBaculovirus expression of human Senataxin helicase domain for protein productionDepositorInsertSenataxin (SETX Human)
UseTagsFlagExpressionInsect and MammalianMutationcodon optimized for insect cell expressionPromoterhybrid p10 (insect) and CMV (human) expressionAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q79
Plasmid#111729PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ79 (polyQ repeat)PromoterCMV and P10Available sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q19
Plasmid#111741PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ19 (polyQ repeat)PromoterCMV and P10Available sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 D962N
Plasmid#171821Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 D962NDepositorInserthuman ATP13A2 (ATP13A2 Human)
UseLentiviralTagsExpressionMutationWT, D508NPromoterCMVAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1A KI
Plasmid#131480PurposeEndogenous tagging of CaV2.1, P/Q: N-terminal (amino acid position: G10)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N-flag_huntingtin_full-length_Q139
Plasmid#111738PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ139 (polyQ repeat)PromoterCMV and P10Available sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB4
Plasmid#116736PurposeLentiviral expression of ERBB4DepositorInsertERBB4 (ERBB4 Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N-flag_huntingtin_full-length_Q51
Plasmid#111734PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ51 (polyQ repeat)PromoterCMV and P10Available sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-18Q-myc-WPRE
Plasmid#107936PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of wild type HTT (wtHTT, 18 polyQ repeats) in neuronsDepositorInsertExon 1 of wild type HTT (HTT Human)
UseAAVTagsExpressionMutationPromoterhSynapsinAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only