We narrowed to 12,862 results for: lic
-
Plasmid#67615Purposebacterial expression of wild type GST-SF3B2 fragment (401-550)DepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
UseTagsGSTExpressionBacterialMutationfragment of amino acids 401-550PromotertacAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
UseTagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…PromoterAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D500-630
Plasmid#19841DepositorInsertMKL1 D500-630 (MRTFA Human)
UseTags3xFLAGExpressionMammalianMutationdeleted amino acids 500-630PromoterAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D381-506
Plasmid#19853DepositorInsertMKL1 (MRTFA Human)
UseTags3xFLAGExpressionMammalianMutationdeleted amino acids 381 to 506PromoterAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
exon L-firefly
Plasmid#81006Purposeluciferase based mini-gene to report splicing at exon 25 in Drosophila paraylticDepositorInsertparalytic (para Fly)
UseTagsfirefly luciferaseExpressionInsectMutationspanning exon 24 to exon 26, termination codon in…PromoterP-AC5 (Actin 5C)Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 L272A
Plasmid#19850DepositorInsertMKL1 L272A (MRTFA Human)
UseTags3xFLAGExpressionMammalianMutationchanged Leucine 272 to AlaninePromoterAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-630
Plasmid#19840DepositorInsertMKL1 D444-630 (MRTFA Human)
UseTags3xFLAGExpressionMammalianMutationdeleted amino acids 444-630PromoterAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S449A
Plasmid#19842DepositorInsertMKL1 S449A (MRTFA Human)
UseTags3xFLAGExpressionMammalianMutationchanged Serine 449 to AlaninePromoterAvailable sinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.2
Plasmid#46681PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.2 (MIR16-1 Human, Synthetic)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorInsertNfasc (Nfasc Rat)
UseTagsHA-tagExpressionMammalianMutationK519TAGPromoterCMVAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K534TAG)-HA
Plasmid#239776PurposeExpresses rat NF186 with a TAG codon at position 534 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorInsertNfasc (Nfasc Rat)
UseTagsHA-tagExpressionMammalianMutationK534TAGPromoterCMVAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K571TAG)-HA
Plasmid#239777PurposeExpresses rat NF186 with a TAG codon at position 571 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorInsertNfasc (Nfasc Rat)
UseTagsHA-tagExpressionMammalianMutationK571TAGPromoterCMVAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only