We narrowed to 14,123 results for: cas9
-
Plasmid#207375PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertBlackjack SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationamino acids 1005-1013 replaced with two glycinePromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL28_Cas9-His Δcys E532C/E1207C
Plasmid#206289PurposeBacterial expression of SpCas9 Δcys E532C and E1027C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E1207CPromoterT7Available SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL27_Cas9-His Δcys E532C/E945C
Plasmid#206288PurposeBacterial expression of SpCas9 Δcys E532C and E945C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E945CPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL26_Cas9-His Δcys M1C/E532C
Plasmid#206287PurposeBacterial expression of SpCas9 Δcys M1C and E532C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, E532C, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-BACH1 Cas9-Resistant
Plasmid#199218PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Negative-Feedback circuit (mNF-BACH1 Cas9- resistant). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…PromoterCMV D2ir promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only