We narrowed to 9,280 results for: Pol
-
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2704-AGER-gRNA3
Plasmid#216473Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2705-AGER-eGFP
Plasmid#216474Purposedonor vector for targeting an eGFP reporter to the human AGER locus at the endogenous ATG start siteDepositorInserteGFP
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K48R/K63R)-GFP
Plasmid#212795PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R/K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R/K63R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K48R/K63R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_S172A_M173A RAD23A
Plasmid#201574PurposeExpresses a variant of human RAD23A containing mutations S172A and M173A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations S172A and M173AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V195A RAD23A
Plasmid#201575PurposeExpresses a variant of human RAD23A containing mutation V195A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation V195AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A RAD23A
Plasmid#201577PurposeExpresses a variant of human RAD23A containing mutation C344A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation C344AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F354A RAD23A
Plasmid#201578PurposeExpresses a variant of human RAD23A containing mutation F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutation F354AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A_F354A RAD23A
Plasmid#201579PurposeExpresses a variant of human RAD23A containing mutations C344A and F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations C344A and F354AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23B_delta aa 276-339 (delta XPC-binding domain)
Plasmid#201547PurposeExpresses a mutant form of human RAD23B that lacks the XPC-binding domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationLacks residues 276-339Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc253
Plasmid#207464PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 253DepositorInsertMTdTc253 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationSer253Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc188
Plasmid#207463PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 188DepositorInsertTdTc188 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys216Ser, Cys302Ala, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc180
Plasmid#207462PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 180DepositorInsertTdTc180 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationGlu180Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc302
Plasmid#207461PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 302DepositorInsertTdTc302 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196883PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-Lyn-GFP-bGH]
Plasmid#196884PurposeDual Cre/Dre-dependent expression of LynGFP. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-Lyn-GFP-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196886PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Halo-Dync1h1motor
Plasmid#191333PurposeExpresses the fluorescently labeled dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Halo-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H258A 3xFlag-V5
Plasmid#174130PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
Tags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mClover3-bElys
Plasmid#171494PurposeT7 promotor drives in vitro transcription of mClover3-tagged bovine Elys mRNADepositorAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX030
Plasmid#167154PurposeMoClo-compatible Level 1 (position 5) vector encoding Neonothopanus nambi caffeoylpiruvate hydrolase nnCPH under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnCPH-ocsT
ExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
ExpressionPlantPromoterpNOSAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Flag-Rheb-12Rs
Plasmid#165023Purposeexpression of Flag-Rheb-12Rs mutant protein in mammalian cells (all the lysine residues on Rheb except the K19 and K120 are mutated to arginines).DepositorInsertRheb-12Rs (RHEB Human)
UseLentiviralTagsflagExpressionMammalianMutationAll the lysine residues except K19 and K120 are c…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A Prk-
Plasmid#162694Purposep1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialMutationPrk inactive (K20M S21A native protein, this map …PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-2
Plasmid#159930PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Mm_Plk5(300-595) PBD domain
Plasmid#136316PurposeMammalian expression of mouse Plk5-D300 (PBD domain 300-595) with N-terminal EGFPDepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR-IL22
Plasmid#153070PurposeHuman IL-22 3'UTR region cloned downstream of luciferase reporter geneDepositorAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-598)_quadruple_mutant
Plasmid#135441PurposeExpresses SFPQ 214-598 quadruple mutant (L535A, L539A, L546A, M549A) with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialMutationL535A, L539A, L546A, M549APromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoBa
Plasmid#121897PurposePlasmid for making zebrafish apoBa in situ probeDepositorInsertApoBa (apoba Zebrafish)
UseUnspecifiedAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 T78R L84R T92R V118R
Plasmid#112106PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorInsertDynamin1 (DNM1 Human)
TagsEGFPExpressionMammalianMutationT78R L84R T92R V118RPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
hASXL(1-115)-luciferase
Plasmid#106427PurposeExpresses human ASXL1 (amino acids 1-115) fused to the N-terminal of firefly luciferaseDepositorInsertaddition sex combs like 1 ASXL1 (ASXL1 Human)
TagsluciferaseExpressionMammalianMutationamino acids 1-115 fused to luciferaseAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only