We narrowed to 8,860 results for: sgRNA
-
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT-9251
Plasmid#124226PurposeBacterial SpCas9-HF1 expressionDepositorInsertSpCas9-HF1
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-Cdt1
Plasmid#122342PurposeExpresses sgRNA targeting mouse Cdt1 and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Cdt1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa1.2
Plasmid#136373PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 1.2 is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP303-4
Plasmid#66088Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs1
UseCRISPRExpressionWormPromoterU6Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-5
Plasmid#66096Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRExpressionWormPromoterU6Available SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5271
Plasmid#66085Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRExpressionWormPromoterU6Available SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 54
Plasmid#66100Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 54
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
APCSD 53
Plasmid#66099Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2DepositorInsertsgRNA for CSD 53
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-6
Plasmid#66097Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP334-2
Plasmid#66095Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs5
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP324-4
Plasmid#66094Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2DepositorInsertsgRNA for APs6
UseCRISPRExpressionWormPromoterU6Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only