We narrowed to 14,172 results for: cas9
-
Plasmid#103111PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG9QLF2(Cas9 coding gene from Bacillus smithii 7_3_47FAA)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B1UZL4
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P2
Plasmid#80944PurposeExpresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 bindingDepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-HITI-2c ACTB
Plasmid#206267PurposeAll in one recombinant baculovirus production vector. Encodes Cas9, sgRNA and donor for homology independent targeted integration in the ACTB locus.DepositorInsertSpCas9 (S. Pyogenes), hACTB HITI-2c donor, mCherry, Puro-R, hU6 hACTB sgRNA, AcrIIA4, eGFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJCble
Plasmid#185861PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a phleomycin-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; ble
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EF1-BLST-Cas9-VPR
Plasmid#115147PurposeSafe harbor site 231 knock-in vector with BlastR-Cas9-VPR expression cassetteDepositorInsertBlastR-P2A-Cas9-VPR
UseCRISPRTagsSV40NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2815 pPB: CAG-Puro-WPRE PGK-KRAB-tagBFP-SpdCas9
Plasmid#84245PurposeExpresses direct fusion KRAB-Sp dCas9DepositorInsertsKRAB-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, KRAB, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon4
Plasmid#217455PurposeFor TP53 knockout targeting exon 4 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDD426
Plasmid#202079PurposeFrame +1/-0 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +1/-0 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT259 Lenti pEF-dCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
Plasmid#187335PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2814 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SpdCas9
Plasmid#84247PurposeExpresses direct fusion VPR-Sp dCas9DepositorInsertsVPR-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, VPR, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11197
Plasmid#191784PurposeSpCas9 expression in plantsDepositorInsertAtUbi10::Cas9 +13 introns-T-E9
UseCRISPRExpressionPlantAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only