We narrowed to 4,467 results for: Erf
-
Plasmid#248031PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL2 (IL2 Human)
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
Plasmid#248032PurposeConstitutively expresses myc tagged membrane bound IL15, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL15 (IL15 Human)
UseLentiviralTagsMycExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA
Plasmid#108692PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A, allowing affinity purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon a…PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7s
Plasmid#104463PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7s
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7b
Plasmid#104484PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7b
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP6
Plasmid#141260PurposeGateway-compatible Entry vector, with insert of NSP6 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertNSP6 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-CRISPR-v2-gYap-1
Plasmid#166481PurposeExpresses spCas9 and a gRNA targeting mouse YapDepositorInsertgRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 E
Plasmid#141273PurposeGateway-compatible Entry vector, with insert of the envelope (E) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertE (E SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR207 SARS-CoV-2 M
Plasmid#141274PurposeGateway-compatible Entry vector, with insert of the membrane (M) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertM (M SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 S
Plasmid#149329PurposeGateway-compatible Entry vector, with insert of the spike (S) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 NSP16
Plasmid#141269PurposeGateway-compatible Entry vector, with insert of NSP16 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertNSP16 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSico p53
Plasmid#12089PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP12
Plasmid#141265PurposeGateway-compatible Entry vector, with insert of NSP12 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertNSP12 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Gene ID 43740578)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits