We narrowed to 7,693 results for: tet on
-
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAB822
Plasmid#47856PurposeBIOFAB reporter plasmid for measuring BBa_B1006 termination efficiencyDepositorInsertBBa_B1006 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO11Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB803
Plasmid#47847PurposeBIOFAB reporter plasmid for measuring T7 early termination efficiencyDepositorInsertT7 early terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO2Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
NLS-dCas9-HA-NLS-GFP4-VPR
Plasmid#183924PurposeVPR activation domain coupled to catalytically inactive dCas9 for localization; contains a GFP tetramer fpr labeling and as a spacerDepositorInsertdCas9-GFP4-VPR
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEos2-CD151-7
Plasmid#57358PurposeLocalization: Tetraspanin/Membrane, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
p5B3-T
Plasmid#92021PurposeExpresses TALE targeted to lysA promoter with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lysA with N-terminal TEV protease cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPyCAG-NE-EGFP-IRES-Pac
Plasmid#183617PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.DepositorInsertEGFP
TagsHuman EMD transmembrane domain and NLSExpressionMammalianPromoterCAGAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-HcRed
Plasmid#67035PurposePlasmid for Paph-HcRed integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
HcRed
UseConjugative bacterial vectorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-vcDAB
Plasmid#133004PurposepFE carrying the vcdabA2 ( locus_tag: CSW01_RS07960) and vcdabB2 genes (locus_tag: CSW01_RS07955)DepositorInsertsvcdabB
vcdabA
ExpressionBacterialPromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-SwiChR-eYFP
Plasmid#166604PurposeEncodes Cre-dependent SwiChR-eYFP under control of the TREDepositorInsertSwiChR-eYFP
UseAAVPromotertetracycline response elementAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyExpressionBacterialMutationwt LacI without the tetramerization domainAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL600
Plasmid#37563DepositorUseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBABE-tTA-SV40-puro-T2A-TagBFP
Plasmid#254076PurposeRetroviral transfer vector for tTA expression, puromycin selection marker.DepositorInserttTA
UseRetroviralAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B-TLS
Plasmid#245879PurposeGolden gate entry vector carrying TLS mobile RNA sequenceDepositorInsertTLS2
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-PtALSgRNA
Plasmid#245880PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS geneDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-TLS
Plasmid#245882PurposeGolden gate entry vector carrying TLS mobile RNA sequenceDepositorInsertTLS2
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-FCY-UPP
Plasmid#245873PurposeGolden gate entry vector carrying expression cassette for genes FCY and UPPDepositorInsertFCY1-UPP
UseCRISPRExpressionPlantPromoterAtUBQ10Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTKI-Tyr
Plasmid#247647PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKI-Ser
Plasmid#247648PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCherry-PhoCl AND A-SpyTag
Plasmid#246950PurposeExpresses multifunctional construct for AND-gated release of mCherry from materials in response to 405 nm light AND sortase eSrtA(2A9) treatment. Contains a SpyTag for material tethering.DepositorInsertPlease see depositor comments below
Tags6x His tag, SsrAExpressionBacterialAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
mGreenLantern-[(A OR S) AND T] OR (C AND V)-SpyTag
Plasmid#243789PurposeExpresses multifunctional construct enabling the [AND/(OR)]OR(AND)-gated release of mGreenLantern from materials in response to sortase eSrtA(2A9), sortase eSrtA(4S9), TEV, HRV-3C, TEV and TVMV proteases. Construct contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCK948
Plasmid#242917PurposeConstitutive expression of dCas9, MCP-TetD, and PspF-λN22DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKO025
Plasmid#242913PurposeaTc-inducible expression of Spy-dCas9-AsiA and Sth1-dCas9, and constitutive expression of MCP-SoxSDepositorInsertSth1-dCas9
UseCRISPR and Synthetic BiologyPromoterPtetAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-shControl-mCherry-CAAX
Plasmid#227689PurposeMembrane tethered mCherry and scramble of shRNA targeting Atg7DepositorInsertscrambled shRNA control
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mem-seTurboID
Plasmid#237888PurposeAAV vector encoding membrane-tethered seTurboID under the control of human synapsin promoterDepositorInsertmem-seTurboID
UseAAVTagsGAP43 palmitoylation signal and V5 tagExpressionMammalianPromoterhuman Synapsin 1 (hSyn)Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ36-72
Plasmid#232060PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 36-72DepositorInsertNeurofilament-Heavy tail domain lacking residues 36-72
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ462-638
Plasmid#232061PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 462-638DepositorInsertNeurofilament-Heavy tail domain lacking residues 462-638
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFLtail
Plasmid#232055PurposeExpresses construct for surface tethering: R. norvegicus NFL tail domainDepositorInsertNeurofilament-Light tail domain
Tags6xHisExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMtail
Plasmid#232056PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domainDepositorInsertNeurofilament-Medium tail domain
Tags6xHis, thrombinExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMshuf1
Plasmid#232058PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 1DepositorInsertNeurofilament-Medium tail domain, charge shuffle 1
Tags6xHis, thrombinExpressionBacterialAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHtail
Plasmid#232057PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domainDepositorInsertNeurofilament-Heavy tail domain
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMshuf2
Plasmid#232059PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 2DepositorInsertNeurofilament-Medium tail domain, charge shuffle 2
Tags6xHis, thrombinExpressionBacterialAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHM148
Plasmid#225532PurposeEncodes constitutive rtTA, tetOn-Pcdh19-GFP, and constitutive mCherryDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2H12ref
Plasmid#221188PurposecdGreen expressed in operon with mScarlet-I from an aTc-inducible promoter (Internal Lab ID: UJ11206)DepositorInsertscdGreen
mScarlet-I
ExpressionBacterialMutationN-terminus changed: starts with MSKKYGEAVIKE ...PromoterNone (same as cdGreen) and PtetAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ExSYTE.H64A
Plasmid#216262Purposeinactive ExSYTE.H64A (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVMutationH64A mutation in each oTetRAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMamCol1
Plasmid#215184PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coliDepositorInserttsPurple
UseAAV, CRISPR, and Synthetic Biology ; Recombinant …TagsSNAC-StrepII tagExpressionBacterial and MammalianPromoterTetON 3G Bidirectional for Mammalian and Trc with…Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only