-
Plasmid#194008PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide A)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-aV guide B
Plasmid#194009PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide B)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-a5 guide A
Plasmid#194010PurposeFor CRISPR knockout of integrin alpha5DepositorInsertsingle-guide RNA (a5_guide A)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDNR-SpCas9-Cdt1
Plasmid#80426PurposeUsed for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle.DepositorInsertSpCas9-Cdt1
UseCRISPRTagsCdt1ExpressionMutationcodon optimized for humanPromoterAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorInsertMAPRE1 gRNA #1 (targets Exon 1) (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTrex-b-NLS-hSpCas9
Plasmid#62543PurposeExpression of Cas9 in T. cruziDepositorInsertNLS-hSpCas9
UseCRISPR; Trypanosoma cruzi expressionTags3xFLAG and NLSExpressionMutationPromoterRibo-HX1Available sinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-NoABE
Plasmid#209043PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized SpCas9(D10A)-6xNLS (Cas9 nickase)DepositorInsertnSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
G1333 DddAtox-N–dSpCas9
Plasmid#157833Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1333 DddAtox-N–dSpCas9–UGI–UGI–bpNLS
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g10
Plasmid#80793PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 10/20/30 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianMutationPromoterU6Available sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianMutationPromoterCbhAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta-mmr
Plasmid#169241PurposeCas9, beta, and mutL mutant expression plasmid for introducing chromosomal point mutationsDepositorInsertscas9
beta
mutL-E36K
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationChanged glutamic acid 36 to lysinePromoterAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-BtW-eSpCas9
Plasmid#133358PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
UseTagsFlag-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-Gsk3b(new)
Plasmid#122341PurposeExpresses sgRNA targeting mouse Gsk3b and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Gsk3b
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only