We narrowed to 2,440 results for: pcas9
-
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDNR-SpCas9-Gem
Plasmid#80424PurposeUsed for in vitro transcription of SpCas9-Gem mRNA. Cas9 is fused to Geminin peptide and is degraded during G0/G1 phases of the cell-cycle to minimize indels caused by non-homologous end joiningDepositorInsertSpCas9-Gem
UseCRISPRTagsGemininMutationcodon optimized for humanPromoterT7Available SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
spCas9-NLS-MAV
Plasmid#124212PurposeSpCas9-NLS 17 amino acid linker to monoavidin (SpCas9-NLS-MAV)DepositorInsertcas9
UseCRISPRTagsHis6, MBP, TEV Cleavage site, and two copies of S…ExpressionBacterialPromoterT7Available SinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDNR-SpCas9-Cdt1
Plasmid#80426PurposeUsed for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle.DepositorInsertSpCas9-Cdt1
UseCRISPRTagsCdt1Mutationcodon optimized for humanAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
ER50-SpCas9-ER50
Plasmid#85448PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cellsDepositorInsertER50-SpCas9-ER50
UseAAVTagsdestabilized domain of estrogen receptor ligand b…ExpressionMammalianPromoterCbhAvailable SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Human, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-SsAPOBEC3B
Plasmid#198550PurposeExpresses human codon-optimized SpCas9-NRCH-SsAPOBEC3B and blasticidin resistance: EFS promoter-SpCas9-NRCH-SsAPOBEC3B-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-SsAPOBEC3B
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-BFP empty
Plasmid#80976PurposeCas9, TagBFP, and sgRNA expressionDepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNS20-SpCas9-SNAP
Plasmid#113717PurposeBacterial vector for expression of Snap-tagged Streptococcus pyogenes Cas9DepositorInsertCas9
UseCRISPRTagsHA-2xNLS-SNAP-NLS and His6-MBP-TEVExpressionBacterialAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
Plasmid#110302PurposeExpresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-spCas9-pNeo
Plasmid#214120PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertspCas9
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG
Plasmid#79877PurposeFLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid.DepositorTypeEmpty backboneUseCRISPRTagsUntagged eSpCas9(1.1)ExpressionMammalianPromoterCBhAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-N–dSpCas9
Plasmid#157835Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1397 DddAtox-N–dSpCas9–UGI–UGI–bpNLS
UseCRISPRAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpCas9 TadCBEa-V106W
Plasmid#193838PurposeExpress TadCBEa-V106W (with SpCas9) in mammalian cellsDepositorInsertTadA-CDa V106W-SpCas9 D10A
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Hyg
Plasmid#232095PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P823_eSpCas9(1.1)-RecA
Plasmid#87264PurposeHuman codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiencyDepositorInsertRecA
TagsFLAGExpressionMammalianPromoterCBhAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only